e.g. 1:1246..9423
SNP Detail For snp_cf0015000371005    [See in GBrowse]
1.General Information
SNP ID: snp_cf0015000371005
Organism: Canis familiaris
Individual: DQ7
Create time: 2014-07-19
Last update: 2014-07-19
2.Allele Information
Platform: SOLEXA
Method: sequence
SNP Class: snp
Genotype: C
5'flank: GGTCAGGATGGGCGCCGACCAGCCCTCCGA
3'flank: AACGCCTGAGGCTTCCCCGCGCTCCGCAGT
3.Reference Map information
Chrom Position Reference DQ7
Chr11 2127454 A C
4.Gene information
Gene model(s)
Gene ID Position in Gene Strands Gene Allele Location
ENSCAFG00000000344 741 - A CDS
Transcript Protein
SNP to transcript Accession Position in Transcript Allele change Accession Position in Protein Residue change
- ENSCAFT00000047107 267 TTT => TTG ENSCAFP00000038523 89 F => L
- ENSCAFT00000000538 135 TTT => TTG ENSCAFP00000000488 45 F => L
5.SNPs of other individuals in this position
SNP_ID Individual Genotype 5' Near Seq 30 bp 3' Near Seq 30 bp Create time Last update time
snp_cf0010000370853 DQ2 C GGTCAGGATGGGCGCCGACCAGCCCTCCGA AACGCCTGAGGCTTCCCCGCGCTCCGCAGT 2014-07-19 2014-07-19
snp_cf0042000359081 KM7 C GGTCAGGATGGGCGCCGACCAGCCCTCCGA AACGCCTGAGGCTTCCCCGCGCTCCGCAGT 2014-07-19 2014-07-19
snp_cf0012000364917 DQ4 C GGTCAGGATGGGCGCCGACCAGCCCTCCGA AACGCCTGAGGCTTCCCCGCGCTCCGCAGT 2014-07-19 2014-07-19
snp_cf0035000349661 KM10 C GGTCAGGATGGGCGCCGACCAGCCCTCCGA AACGCCTGAGGCTTCCCCGCGCTCCGCAGT 2014-07-19 2014-07-19
snp_cf0009000370439 DQ1 C GGTCAGGATGGGCGCCGACCAGCCCTCCGA AACGCCTGAGGCTTCCCCGCGCTCCGCAGT 2014-07-19 2014-07-19
snp_cf0032000274130 GS8 C GGTCAGGATGGGCGCCGACCAGCCCTCCGA AACGCCTGAGGCTTCCCCGCGCTCCGCAGT 2014-07-19 2014-07-19
snp_cf0005000446577 CHW C GGTCAGGATGGGCGCCGACCAGCCCTCCGA AACGCCTGAGGCTTCCCCGCGCTCCGCAGT 2014-07-19 2014-07-19
snp_cf0036000298991 KM1 C GGTCAGGATGGGCGCCGACCAGCCCTCCGA AACGCCTGAGGCTTCCCCGCGCTCCGCAGT 2014-07-19 2014-07-19
snp_cf0014000359986 DQ6 C GGTCAGGATGGGCGCCGACCAGCCCTCCGA AACGCCTGAGGCTTCCCCGCGCTCCGCAGT 2014-07-19 2014-07-19
snp_cf0016000372161 DQ8 C GGTCAGGATGGGCGCCGACCAGCCCTCCGA AACGCCTGAGGCTTCCCCGCGCTCCGCAGT 2014-07-19 2014-07-19
snp_cf0031000293847 GS7 C GGTCAGGATGGGCGCCGACCAGCCCTCCGA AACGCCTGAGGCTTCCCCGCGCTCCGCAGT 2014-07-19 2014-07-19
snp_cf0037000314792 KM2 C GGTCAGGATGGGCGCCGACCAGCCCTCCGA AACGCCTGAGGCTTCCCCGCGCTCCGCAGT 2014-07-19 2014-07-19
snp_cf0059000374339 TM10 C GGTCAGGATGGGCGCCGACCAGCCCTCCGA AACGCCTGAGGCTTCCCCGCGCTCCGCAGT 2014-07-19 2014-07-19
snp_cf0070000390736 YJ1 C GGTCAGGATGGGCGCCGACCAGCCCTCCGA AACGCCTGAGGCTTCCCCGCGCTCCGCAGT 2014-07-19 2014-07-19
snp_cf0026000286679 GS2 C GGTCAGGATGGGCGCCGACCAGCCCTCCGA AACGCCTGAGGCTTCCCCGCGCTCCGCAGT 2014-07-19 2014-07-19
snp_cf0043000315625 KM8 C GGTCAGGATGGGCGCCGACCAGCCCTCCGA AACGCCTGAGGCTTCCCCGCGCTCCGCAGT 2014-07-19 2014-07-19
snp_cf0049000375295 LJ4 C GGTCAGGATGGGCGCCGACCAGCCCTCCGA AACGCCTGAGGCTTCCCCGCGCTCCGCAGT 2014-07-19 2014-07-19
snp_cf0013000375672 DQ5 C GGTCAGGATGGGCGCCGACCAGCCCTCCGA AACGCCTGAGGCTTCCCCGCGCTCCGCAGT 2014-07-19 2014-07-19
snp_cf0008000362819 DQ10 C GGTCAGGATGGGCGCCGACCAGCCCTCCGA AACGCCTGAGGCTTCCCCGCGCTCCGCAGT 2014-07-19 2014-07-19
snp_cf0029000238034 GS5 C GGTCAGGATGGGCGCCGACCAGCCCTCCGA AACGCCTGAGGCTTCCCCGCGCTCCGCAGT 2014-07-19 2014-07-19
snp_cf0028000272456 GS4 C GGTCAGGATGGGCGCCGACCAGCCCTCCGA AACGCCTGAGGCTTCCCCGCGCTCCGCAGT 2014-07-19 2014-07-19
snp_cf0038000294410 KM3 C GGTCAGGATGGGCGCCGACCAGCCCTCCGA AACGCCTGAGGCTTCCCCGCGCTCCGCAGT 2014-07-19 2014-07-19
snp_cf0068000356316 TM9 C GGTCAGGATGGGCGCCGACCAGCCCTCCGA AACGCCTGAGGCTTCCCCGCGCTCCGCAGT 2014-07-19 2014-07-19
snp_cf0065000351361 TM6 C GGTCAGGATGGGCGCCGACCAGCCCTCCGA AACGCCTGAGGCTTCCCCGCGCTCCGCAGT 2014-07-19 2014-07-19
snp_cf0074000376225 YJ5 C GGTCAGGATGGGCGCCGACCAGCCCTCCGA AACGCCTGAGGCTTCCCCGCGCTCCGCAGT 2014-07-19 2014-07-19
snp_cf0066000376897 TM7 C GGTCAGGATGGGCGCCGACCAGCCCTCCGA AACGCCTGAGGCTTCCCCGCGCTCCGCAGT 2014-07-19 2014-07-19
snp_cf0027000285080 GS3 C GGTCAGGATGGGCGCCGACCAGCCCTCCGA AACGCCTGAGGCTTCCCCGCGCTCCGCAGT 2014-07-19 2014-07-19
snp_cf0077000375919 YJ8 C GGTCAGGATGGGCGCCGACCAGCCCTCCGA AACGCCTGAGGCTTCCCCGCGCTCCGCAGT 2014-07-19 2014-07-19
snp_cf0061000374833 TM2 C GGTCAGGATGGGCGCCGACCAGCCCTCCGA AACGCCTGAGGCTTCCCCGCGCTCCGCAGT 2014-07-19 2014-07-19
snp_cf0044000325479 KM9 C GGTCAGGATGGGCGCCGACCAGCCCTCCGA AACGCCTGAGGCTTCCCCGCGCTCCGCAGT 2014-07-19 2014-07-19
snp_cf0025000271635 GS1 C GGTCAGGATGGGCGCCGACCAGCCCTCCGA AACGCCTGAGGCTTCCCCGCGCTCCGCAGT 2014-07-19 2014-07-19
snp_cf0073000382688 YJ4 C GGTCAGGATGGGCGCCGACCAGCCCTCCGA AACGCCTGAGGCTTCCCCGCGCTCCGCAGT 2014-07-19 2014-07-19
snp_cf0040000310766 KM5 C GGTCAGGATGGGCGCCGACCAGCCCTCCGA AACGCCTGAGGCTTCCCCGCGCTCCGCAGT 2014-07-19 2014-07-19
snp_cf0064000378347 TM5 C GGTCAGGATGGGCGCCGACCAGCCCTCCGA AACGCCTGAGGCTTCCCCGCGCTCCGCAGT 2014-07-19 2014-07-19
snp_cf0078000381789 YJ9 C GGTCAGGATGGGCGCCGACCAGCCCTCCGA AACGCCTGAGGCTTCCCCGCGCTCCGCAGT 2014-07-19 2014-07-19
snp_cf0030000291940 GS6 C GGTCAGGATGGGCGCCGACCAGCCCTCCGA AACGCCTGAGGCTTCCCCGCGCTCCGCAGT 2014-07-19 2014-07-19
snp_cf0033000302929 GS9 C GGTCAGGATGGGCGCCGACCAGCCCTCCGA AACGCCTGAGGCTTCCCCGCGCTCCGCAGT 2014-07-19 2014-07-19
snp_cf0017000382183 DQ9 C GGTCAGGATGGGCGCCGACCAGCCCTCCGA AACGCCTGAGGCTTCCCCGCGCTCCGCAGT 2014-07-19 2014-07-19
snp_cf0076000380554 YJ7 C GGTCAGGATGGGCGCCGACCAGCCCTCCGA AACGCCTGAGGCTTCCCCGCGCTCCGCAGT 2014-07-19 2014-07-19
snp_cf0071000374889 YJ2 C GGTCAGGATGGGCGCCGACCAGCCCTCCGA AACGCCTGAGGCTTCCCCGCGCTCCGCAGT 2014-07-19 2014-07-19
snp_cf0072000381891 YJ3 C GGTCAGGATGGGCGCCGACCAGCCCTCCGA AACGCCTGAGGCTTCCCCGCGCTCCGCAGT 2014-07-19 2014-07-19
snp_cf0062000376092 TM3 C GGTCAGGATGGGCGCCGACCAGCCCTCCGA AACGCCTGAGGCTTCCCCGCGCTCCGCAGT 2014-07-19 2014-07-19
snp_cf0057000459272 LUPWRUS00002 C GGTCAGGATGGGCGCCGACCAGCCCTCCGA AACGCCTGAGGCTTCCCCGCGCTCCGCAGT 2014-07-19 2014-07-19
snp_cf0069000381636 YJ10 C GGTCAGGATGGGCGCCGACCAGCCCTCCGA AACGCCTGAGGCTTCCCCGCGCTCCGCAGT 2014-07-19 2014-07-19
snp_cf0060000377512 TM1 C GGTCAGGATGGGCGCCGACCAGCCCTCCGA AACGCCTGAGGCTTCCCCGCGCTCCGCAGT 2014-07-19 2014-07-19
snp_cf0075000383697 YJ6 C GGTCAGGATGGGCGCCGACCAGCCCTCCGA AACGCCTGAGGCTTCCCCGCGCTCCGCAGT 2014-07-19 2014-07-19
snp_cf0011000373387 DQ3 C GGTCAGGATGGGCGCCGACCAGCCCTCCGA AACGCCTGAGGCTTCCCCGCGCTCCGCAGT 2014-07-19 2014-07-19
snp_cf0052000355413 LJ7 C GGTCAGGATGGGCGCCGACCAGCCCTCCGA AACGCCTGAGGCTTCCCCGCGCTCCGCAGT 2014-07-19 2014-07-19
snp_cf0039000288498 KM4 C GGTCAGGATGGGCGCCGACCAGCCCTCCGA AACGCCTGAGGCTTCCCCGCGCTCCGCAGT 2014-07-19 2014-07-19
snp_cf0041000347600 KM6 C GGTCAGGATGGGCGCCGACCAGCCCTCCGA AACGCCTGAGGCTTCCCCGCGCTCCGCAGT 2014-07-19 2014-07-19
snp_cf0024000312891 GS10 C GGTCAGGATGGGCGCCGACCAGCCCTCCGA AACGCCTGAGGCTTCCCCGCGCTCCGCAGT 2014-07-19 2014-07-19
6.Fasta Information
CCCGTGGCCT TCCGCGCCAG GGTCAGGATG GGCGCCGACC AGCCCTCCGA
C
AACGCCTGAG GCTTCCCCGC GCTCCGCAGT TCGCAGGGGC TAGGCAGCTG