e.g. 1:1246..9423
SNP Detail For snp_cf0016000000001    [See in GBrowse]
1.General Information
SNP ID: snp_cf0016000000001
Organism: Canis familiaris
Individual: DQ8
Create time: 2014-07-19
Last update: 2014-07-19
2.Allele Information
Platform: SOLEXA
Method: sequence
SNP Class: snp
Genotype: R
5'flank: GCTGGGAGAGGTTTCGGGAAAAGCATGTGT
3'flank: AGCATTGGGCCTGAACTCCCGTGTATCTGA
3.Reference Map information
Chrom Position Reference DQ8
Chr1 6395 A R
4.Gene information
Gene model(s)
Gene ID Position in Gene Strands Gene Allele Location
NA NA NA NA NA
Transcript Protein
SNP to transcript Accession Position in Transcript Allele change Accession Position in Protein Residue change
NA NA NA NA NA NA NA
5.SNPs of other individuals in this position
SNP_ID Individual Genotype 5' Near Seq 30 bp 3' Near Seq 30 bp Create time Last update time
snp_cf0057000000001 LUPWRUS00002 G GCTGGGAGAGGTTTCGGGAAAAGCATGTGT AGCATTGGGCCTGAACTCCCGTGTATCTGA 2014-07-19 2014-07-19
snp_cf0060000000002 TM1 G GCTGGGAGAGGTTTCGGGAAAAGCATGTGT AGCATTGGGCCTGAACTCCCGTGTATCTGA 2014-07-19 2014-07-19
snp_cf0005000000001 CHW G GCTGGGAGAGGTTTCGGGAAAAGCATGTGT AGCATTGGGCCTGAACTCCCGTGTATCTGA 2014-07-19 2014-07-19
snp_cf0074000000001 YJ5 G GCTGGGAGAGGTTTCGGGAAAAGCATGTGT AGCATTGGGCCTGAACTCCCGTGTATCTGA 2014-07-19 2014-07-19
snp_cf0045000000001 LJ10 G GCTGGGAGAGGTTTCGGGAAAAGCATGTGT AGCATTGGGCCTGAACTCCCGTGTATCTGA 2014-07-19 2014-07-19
snp_cf0004000000001 Basenji R GCTGGGAGAGGTTTCGGGAAAAGCATGTGT AGCATTGGGCCTGAACTCCCGTGTATCTGA 2014-07-19 2014-07-19
snp_cf0010000000002 DQ2 G GCTGGGAGAGGTTTCGGGAAAAGCATGTGT AGCATTGGGCCTGAACTCCCGTGTATCTGA 2014-07-19 2014-07-19
snp_cf0077000000001 YJ8 G GCTGGGAGAGGTTTCGGGAAAAGCATGTGT AGCATTGGGCCTGAACTCCCGTGTATCTGA 2014-07-19 2014-07-19
snp_cf0051000000001 LJ6 R GCTGGGAGAGGTTTCGGGAAAAGCATGTGT AGCATTGGGCCTGAACTCCCGTGTATCTGA 2014-07-19 2014-07-19
snp_cf0017000000002 DQ9 G GCTGGGAGAGGTTTCGGGAAAAGCATGTGT AGCATTGGGCCTGAACTCCCGTGTATCTGA 2014-07-19 2014-07-19
snp_cf0050000000001 LJ5 G GCTGGGAGAGGTTTCGGGAAAAGCATGTGT AGCATTGGGCCTGAACTCCCGTGTATCTGA 2014-07-19 2014-07-19
snp_cf0024000000001 GS10 G GCTGGGAGAGGTTTCGGGAAAAGCATGTGT AGCATTGGGCCTGAACTCCCGTGTATCTGA 2014-07-19 2014-07-19
snp_cf0029000000001 GS5 G GCTGGGAGAGGTTTCGGGAAAAGCATGTGT AGCATTGGGCCTGAACTCCCGTGTATCTGA 2014-07-19 2014-07-19
snp_cf0015000000001 DQ7 G GCTGGGAGAGGTTTCGGGAAAAGCATGTGT AGCATTGGGCCTGAACTCCCGTGTATCTGA 2014-07-19 2014-07-19
snp_cf0071000000001 YJ2 G GCTGGGAGAGGTTTCGGGAAAAGCATGTGT AGCATTGGGCCTGAACTCCCGTGTATCTGA 2014-07-19 2014-07-19
snp_cf0009000000001 DQ1 G GCTGGGAGAGGTTTCGGGAAAAGCATGTGT AGCATTGGGCCTGAACTCCCGTGTATCTGA 2014-07-19 2014-07-19
snp_cf0006000000001 CRW G GCTGGGAGAGGTTTCGGGAAAAGCATGTGT AGCATTGGGCCTGAACTCCCGTGTATCTGA 2014-07-19 2014-07-19
snp_cf0035000000001 KM10 R GCTGGGAGAGGTTTCGGGAAAAGCATGTGT AGCATTGGGCCTGAACTCCCGTGTATCTGA 2014-07-19 2014-07-19
snp_cf0026000000001 GS2 G GCTGGGAGAGGTTTCGGGAAAAGCATGTGT AGCATTGGGCCTGAACTCCCGTGTATCTGA 2014-07-19 2014-07-19
snp_cf0055000000001 LUPWCHN00001 G GCTGGGAGAGGTTTCGGGAAAAGCATGTGT AGCATTGGGCCTGAACTCCCGTGTATCTGA 2014-07-19 2014-07-19
snp_cf0073000000001 YJ4 G GCTGGGAGAGGTTTCGGGAAAAGCATGTGT AGCATTGGGCCTGAACTCCCGTGTATCTGA 2014-07-19 2014-07-19
snp_cf0049000000002 LJ4 G GCTGGGAGAGGTTTCGGGAAAAGCATGTGT AGCATTGGGCCTGAACTCCCGTGTATCTGA 2014-07-19 2014-07-19
snp_cf0023000000001 FAMICHN00003 G GCTGGGAGAGGTTTCGGGAAAAGCATGTGT AGCATTGGGCCTGAACTCCCGTGTATCTGA 2014-07-19 2014-07-19
snp_cf0011000000001 DQ3 G GCTGGGAGAGGTTTCGGGAAAAGCATGTGT AGCATTGGGCCTGAACTCCCGTGTATCTGA 2014-07-19 2014-07-19
snp_cf0075000000001 YJ6 G GCTGGGAGAGGTTTCGGGAAAAGCATGTGT AGCATTGGGCCTGAACTCCCGTGTATCTGA 2014-07-19 2014-07-19
snp_cf0046000000001 LJ1 R GCTGGGAGAGGTTTCGGGAAAAGCATGTGT AGCATTGGGCCTGAACTCCCGTGTATCTGA 2014-07-19 2014-07-19
snp_cf0078000000001 YJ9 G GCTGGGAGAGGTTTCGGGAAAAGCATGTGT AGCATTGGGCCTGAACTCCCGTGTATCTGA 2014-07-19 2014-07-19
snp_cf0040000000001 KM5 G GCTGGGAGAGGTTTCGGGAAAAGCATGTGT AGCATTGGGCCTGAACTCCCGTGTATCTGA 2014-07-19 2014-07-19
snp_cf0072000000001 YJ3 R GCTGGGAGAGGTTTCGGGAAAAGCATGTGT AGCATTGGGCCTGAACTCCCGTGTATCTGA 2014-07-19 2014-07-19
snp_cf0014000000002 DQ6 G GCTGGGAGAGGTTTCGGGAAAAGCATGTGT AGCATTGGGCCTGAACTCCCGTGTATCTGA 2014-07-19 2014-07-19
snp_cf0007000000001 Dingo G GCTGGGAGAGGTTTCGGGAAAAGCATGTGT AGCATTGGGCCTGAACTCCCGTGTATCTGA 2014-07-19 2014-07-19
snp_cf0069000000001 YJ10 G GCTGGGAGAGGTTTCGGGAAAAGCATGTGT AGCATTGGGCCTGAACTCCCGTGTATCTGA 2014-07-19 2014-07-19
snp_cf0039000000001 KM4 R GCTGGGAGAGGTTTCGGGAAAAGCATGTGT AGCATTGGGCCTGAACTCCCGTGTATCTGA 2014-07-19 2014-07-19
snp_cf0034000000001 ISW G GCTGGGAGAGGTTTCGGGAAAAGCATGTGT AGCATTGGGCCTGAACTCCCGTGTATCTGA 2014-07-19 2014-07-19
snp_cf0019000000001 FAMBGSD00001 G GCTGGGAGAGGTTTCGGGAAAAGCATGTGT AGCATTGGGCCTGAACTCCCGTGTATCTGA 2014-07-19 2014-07-19
snp_cf0066000000001 TM7 G GCTGGGAGAGGTTTCGGGAAAAGCATGTGT AGCATTGGGCCTGAACTCCCGTGTATCTGA 2014-07-19 2014-07-19
6.Fasta Information
CTAACATCCT TATGTTAGTG GCTGGGAGAG GTTTCGGGAA AAGCATGTGT
R
AGCATTGGGC CTGAACTCCC GTGTATCTGA GTTGAATACA GCGATTTCCA