e.g. 1:1246..9423
SNP Detail For snp_cf0016000000003    [See in GBrowse]
1.General Information
SNP ID: snp_cf0016000000003
Organism: Canis familiaris
Individual: DQ8
Create time: 2014-07-19
Last update: 2014-07-19
2.Allele Information
Platform: SOLEXA
Method: sequence
SNP Class: snp
Genotype: Y
5'flank: CCACATCCAGCCTGCTTGTACACTTGGCTT
3'flank: TAAAAGGCCTAGGATCGCTGTTTGACGGAA
3.Reference Map information
Chrom Position Reference DQ8
Chr1 6591 C Y
4.Gene information
Gene model(s)
Gene ID Position in Gene Strands Gene Allele Location
NA NA NA NA NA
Transcript Protein
SNP to transcript Accession Position in Transcript Allele change Accession Position in Protein Residue change
NA NA NA NA NA NA NA
5.SNPs of other individuals in this position
SNP_ID Individual Genotype 5' Near Seq 30 bp 3' Near Seq 30 bp Create time Last update time
snp_cf0009000000003 DQ1 Y CCACATCCAGCCTGCTTGTACACTTGGCTT TAAAAGGCCTAGGATCGCTGTTTGACGGAA 2014-07-19 2014-07-19
snp_cf0015000000003 DQ7 Y CCACATCCAGCCTGCTTGTACACTTGGCTT TAAAAGGCCTAGGATCGCTGTTTGACGGAA 2014-07-19 2014-07-19
snp_cf0051000000003 LJ6 Y CCACATCCAGCCTGCTTGTACACTTGGCTT TAAAAGGCCTAGGATCGCTGTTTGACGGAA 2014-07-19 2014-07-19
6.Fasta Information
TGAGCTTATG GCCTGTACCT CCACATCCAG CCTGCTTGTA CACTTGGCTT
Y
TAAAAGGCCT AGGATCGCTG TTTGACGGAA GTGCTGGGAG AGGTAATTGG