e.g. 1:1246..9423
SNP Detail For snp_cf0016001038415    [See in GBrowse]
1.General Information
SNP ID: snp_cf0016001038415
Organism: Canis familiaris
Individual: DQ8
Create time: 2014-07-19
Last update: 2014-07-19
2.Allele Information
Platform: SOLEXA
Method: sequence
SNP Class: snp
Genotype: C
5'flank: TTTTAAAAAGTTGTAGGATATCGGAGCGCA
3'flank: CAGCACACGAGCGTCCTCTGCCGGTGCCGG
3.Reference Map information
Chrom Position Reference DQ8
Chr16 93460 T C
4.Gene information
Gene model(s)
Gene ID Position in Gene Strands Gene Allele Location
ENSCAFG00000031089 909 - T CDS
Transcript Protein
SNP to transcript Accession Position in Transcript Allele change Accession Position in Protein Residue change
- ENSCAFT00000048823 909 TGA => TGG ENSCAFP00000041015 303 stop_codon => W
5.SNPs of other individuals in this position
SNP_ID Individual Genotype 5' Near Seq 30 bp 3' Near Seq 30 bp Create time Last update time
snp_cf0040000920809 KM5 Y TTTTAAAAAGTTGTAGGATATCGGAGCGCA CAGCACACGAGCGTCCTCTGCCGGTGCCGG 2014-07-19 2014-07-19
snp_cf0031000820101 GS7 Y TTTTAAAAAGTTGTAGGATATCGGAGCGCA CAGCACACGAGCGTCCTCTGCCGGTGCCGG 2014-07-19 2014-07-19
snp_cf0021000986508 FAMICHN00001 Y TTTTAAAAAGTTGTAGGATATCGGAGCGCA CAGCACACGAGCGTCCTCTGCCGGTGCCGG 2014-07-19 2014-07-19
snp_cf0048000994887 LJ3 C TTTTAAAAAGTTGTAGGATATCGGAGCGCA CAGCACACGAGCGTCCTCTGCCGGTGCCGG 2014-07-19 2014-07-19
snp_cf0039000836138 KM4 Y TTTTAAAAAGTTGTAGGATATCGGAGCGCA CAGCACACGAGCGTCCTCTGCCGGTGCCGG 2014-07-19 2014-07-19
snp_cf0030000829741 GS6 C TTTTAAAAAGTTGTAGGATATCGGAGCGCA CAGCACACGAGCGTCCTCTGCCGGTGCCGG 2014-07-19 2014-07-19
snp_cf0063001027913 TM4 Y TTTTAAAAAGTTGTAGGATATCGGAGCGCA CAGCACACGAGCGTCCTCTGCCGGTGCCGG 2014-07-19 2014-07-19
snp_cf0036000825148 KM1 C TTTTAAAAAGTTGTAGGATATCGGAGCGCA CAGCACACGAGCGTCCTCTGCCGGTGCCGG 2014-07-19 2014-07-19
snp_cf0007000883709 Dingo C TTTTAAAAAGTTGTAGGATATCGGAGCGCA CAGCACACGAGCGTCCTCTGCCGGTGCCGG 2014-07-19 2014-07-19
snp_cf0010001043065 DQ2 Y TTTTAAAAAGTTGTAGGATATCGGAGCGCA CAGCACACGAGCGTCCTCTGCCGGTGCCGG 2014-07-19 2014-07-19
snp_cf0053001016053 LJ8 C TTTTAAAAAGTTGTAGGATATCGGAGCGCA CAGCACACGAGCGTCCTCTGCCGGTGCCGG 2014-07-19 2014-07-19
snp_cf0075001070532 YJ6 C TTTTAAAAAGTTGTAGGATATCGGAGCGCA CAGCACACGAGCGTCCTCTGCCGGTGCCGG 2014-07-19 2014-07-19
snp_cf0037000884234 KM2 C TTTTAAAAAGTTGTAGGATATCGGAGCGCA CAGCACACGAGCGTCCTCTGCCGGTGCCGG 2014-07-19 2014-07-19
snp_cf0072001071437 YJ3 Y TTTTAAAAAGTTGTAGGATATCGGAGCGCA CAGCACACGAGCGTCCTCTGCCGGTGCCGG 2014-07-19 2014-07-19
snp_cf0052001017590 LJ7 Y TTTTAAAAAGTTGTAGGATATCGGAGCGCA CAGCACACGAGCGTCCTCTGCCGGTGCCGG 2014-07-19 2014-07-19
snp_cf0028000767932 GS4 Y TTTTAAAAAGTTGTAGGATATCGGAGCGCA CAGCACACGAGCGTCCTCTGCCGGTGCCGG 2014-07-19 2014-07-19
snp_cf0071001064841 YJ2 C TTTTAAAAAGTTGTAGGATATCGGAGCGCA CAGCACACGAGCGTCCTCTGCCGGTGCCGG 2014-07-19 2014-07-19
snp_cf0026000806350 GS2 Y TTTTAAAAAGTTGTAGGATATCGGAGCGCA CAGCACACGAGCGTCCTCTGCCGGTGCCGG 2014-07-19 2014-07-19
snp_cf0073001057215 YJ4 Y TTTTAAAAAGTTGTAGGATATCGGAGCGCA CAGCACACGAGCGTCCTCTGCCGGTGCCGG 2014-07-19 2014-07-19
snp_cf0060001035649 TM1 C TTTTAAAAAGTTGTAGGATATCGGAGCGCA CAGCACACGAGCGTCCTCTGCCGGTGCCGG 2014-07-19 2014-07-19
snp_cf0012001047703 DQ4 Y TTTTAAAAAGTTGTAGGATATCGGAGCGCA CAGCACACGAGCGTCCTCTGCCGGTGCCGG 2014-07-19 2014-07-19
snp_cf0011001055532 DQ3 Y TTTTAAAAAGTTGTAGGATATCGGAGCGCA CAGCACACGAGCGTCCTCTGCCGGTGCCGG 2014-07-19 2014-07-19
snp_cf0013001008454 DQ5 Y TTTTAAAAAGTTGTAGGATATCGGAGCGCA CAGCACACGAGCGTCCTCTGCCGGTGCCGG 2014-07-19 2014-07-19
snp_cf0076001075792 YJ7 Y TTTTAAAAAGTTGTAGGATATCGGAGCGCA CAGCACACGAGCGTCCTCTGCCGGTGCCGG 2014-07-19 2014-07-19
snp_cf0044000923085 KM9 Y TTTTAAAAAGTTGTAGGATATCGGAGCGCA CAGCACACGAGCGTCCTCTGCCGGTGCCGG 2014-07-19 2014-07-19
snp_cf0078001065181 YJ9 Y TTTTAAAAAGTTGTAGGATATCGGAGCGCA CAGCACACGAGCGTCCTCTGCCGGTGCCGG 2014-07-19 2014-07-19
snp_cf0014001026427 DQ6 Y TTTTAAAAAGTTGTAGGATATCGGAGCGCA CAGCACACGAGCGTCCTCTGCCGGTGCCGG 2014-07-19 2014-07-19
snp_cf0061001055589 TM2 Y TTTTAAAAAGTTGTAGGATATCGGAGCGCA CAGCACACGAGCGTCCTCTGCCGGTGCCGG 2014-07-19 2014-07-19
snp_cf0055001308713 LUPWCHN00001 C TTTTAAAAAGTTGTAGGATATCGGAGCGCA CAGCACACGAGCGTCCTCTGCCGGTGCCGG 2014-07-19 2014-07-19
snp_cf0056001322815 LUPWRUS00001 Y TTTTAAAAAGTTGTAGGATATCGGAGCGCA CAGCACACGAGCGTCCTCTGCCGGTGCCGG 2014-07-19 2014-07-19
snp_cf0070001099181 YJ1 Y TTTTAAAAAGTTGTAGGATATCGGAGCGCA CAGCACACGAGCGTCCTCTGCCGGTGCCGG 2014-07-19 2014-07-19
snp_cf0043000867733 KM8 Y TTTTAAAAAGTTGTAGGATATCGGAGCGCA CAGCACACGAGCGTCCTCTGCCGGTGCCGG 2014-07-19 2014-07-19
snp_cf0024000845679 GS10 Y TTTTAAAAAGTTGTAGGATATCGGAGCGCA CAGCACACGAGCGTCCTCTGCCGGTGCCGG 2014-07-19 2014-07-19
snp_cf0034001231933 ISW Y TTTTAAAAAGTTGTAGGATATCGGAGCGCA CAGCACACGAGCGTCCTCTGCCGGTGCCGG 2014-07-19 2014-07-19
snp_cf0035001011241 KM10 Y TTTTAAAAAGTTGTAGGATATCGGAGCGCA CAGCACACGAGCGTCCTCTGCCGGTGCCGG 2014-07-19 2014-07-19
snp_cf0074001060335 YJ5 C TTTTAAAAAGTTGTAGGATATCGGAGCGCA CAGCACACGAGCGTCCTCTGCCGGTGCCGG 2014-07-19 2014-07-19
snp_cf0015001045459 DQ7 Y TTTTAAAAAGTTGTAGGATATCGGAGCGCA CAGCACACGAGCGTCCTCTGCCGGTGCCGG 2014-07-19 2014-07-19
snp_cf0077001053357 YJ8 Y TTTTAAAAAGTTGTAGGATATCGGAGCGCA CAGCACACGAGCGTCCTCTGCCGGTGCCGG 2014-07-19 2014-07-19
6.Fasta Information
TGAATAAATG AATAAGACAT TTTTAAAAAG TTGTAGGATA TCGGAGCGCA
C
CAGCACACGA GCGTCCTCTG CCGGTGCCGG CCGTCGCTGC AGCCCCCGCC