e.g. 1:1246..9423
SNP Detail For snp_cf0016001038418    [See in GBrowse]
1.General Information
SNP ID: snp_cf0016001038418
Organism: Canis familiaris
Individual: DQ8
Create time: 2014-07-19
Last update: 2014-07-19
2.Allele Information
Platform: SOLEXA
Method: sequence
SNP Class: snp
Genotype: Y
5'flank: AGAAGCTGAACTTCGTGCTGTCGGACAGAG
3'flank: GGCCAGCGCAGGGGTGAGCATGTGGTGTGA
3.Reference Map information
Chrom Position Reference DQ8
Chr16 94347 T Y
4.Gene information
Gene model(s)
Gene ID Position in Gene Strands Gene Allele Location
ENSCAFG00000031089 22 - T CDS
ENSCAFG00000025598 635 + T CDS
Transcript Protein
SNP to transcript Accession Position in Transcript Allele change Accession Position in Protein Residue change
- ENSCAFT00000048823 22 ACT => GCT ENSCAFP00000041015 8 T => A
+ ENSCAFT00000039863 140 GTG => GCG ENSCAFP00000035775 47 V => A
5.SNPs of other individuals in this position
SNP_ID Individual Genotype 5' Near Seq 30 bp 3' Near Seq 30 bp Create time Last update time
snp_cf0006001210098 CRW C AGAAGCTGAACTTCGTGCTGTCGGACAGAG GGCCAGCGCAGGGGTGAGCATGTGGTGTGA 2014-07-19 2014-07-19
snp_cf0029000749277 GS5 Y AGAAGCTGAACTTCGTGCTGTCGGACAGAG GGCCAGCGCAGGGGTGAGCATGTGGTGTGA 2014-07-19 2014-07-19
snp_cf0010001043068 DQ2 Y AGAAGCTGAACTTCGTGCTGTCGGACAGAG GGCCAGCGCAGGGGTGAGCATGTGGTGTGA 2014-07-19 2014-07-19
snp_cf0065001013933 TM6 Y AGAAGCTGAACTTCGTGCTGTCGGACAGAG GGCCAGCGCAGGGGTGAGCATGTGGTGTGA 2014-07-19 2014-07-19
snp_cf0008001032854 DQ10 Y AGAAGCTGAACTTCGTGCTGTCGGACAGAG GGCCAGCGCAGGGGTGAGCATGTGGTGTGA 2014-07-19 2014-07-19
snp_cf0011001055535 DQ3 Y AGAAGCTGAACTTCGTGCTGTCGGACAGAG GGCCAGCGCAGGGGTGAGCATGTGGTGTGA 2014-07-19 2014-07-19
snp_cf0052001017593 LJ7 Y AGAAGCTGAACTTCGTGCTGTCGGACAGAG GGCCAGCGCAGGGGTGAGCATGTGGTGTGA 2014-07-19 2014-07-19
snp_cf0014001026430 DQ6 Y AGAAGCTGAACTTCGTGCTGTCGGACAGAG GGCCAGCGCAGGGGTGAGCATGTGGTGTGA 2014-07-19 2014-07-19
snp_cf0068001005178 TM9 Y AGAAGCTGAACTTCGTGCTGTCGGACAGAG GGCCAGCGCAGGGGTGAGCATGTGGTGTGA 2014-07-19 2014-07-19
snp_cf0013001008460 DQ5 Y AGAAGCTGAACTTCGTGCTGTCGGACAGAG GGCCAGCGCAGGGGTGAGCATGTGGTGTGA 2014-07-19 2014-07-19
snp_cf0012001047707 DQ4 Y AGAAGCTGAACTTCGTGCTGTCGGACAGAG GGCCAGCGCAGGGGTGAGCATGTGGTGTGA 2014-07-19 2014-07-19
snp_cf0057001260742 LUPWRUS00002 Y AGAAGCTGAACTTCGTGCTGTCGGACAGAG GGCCAGCGCAGGGGTGAGCATGTGGTGTGA 2014-07-19 2014-07-19
snp_cf0018000867810 FAMBBEM00001 Y AGAAGCTGAACTTCGTGCTGTCGGACAGAG GGCCAGCGCAGGGGTGAGCATGTGGTGTGA 2014-07-19 2014-07-19
snp_cf0077001053364 YJ8 Y AGAAGCTGAACTTCGTGCTGTCGGACAGAG GGCCAGCGCAGGGGTGAGCATGTGGTGTGA 2014-07-19 2014-07-19
snp_cf0033000811180 GS9 Y AGAAGCTGAACTTCGTGCTGTCGGACAGAG GGCCAGCGCAGGGGTGAGCATGTGGTGTGA 2014-07-19 2014-07-19
snp_cf0066001064400 TM7 Y AGAAGCTGAACTTCGTGCTGTCGGACAGAG GGCCAGCGCAGGGGTGAGCATGTGGTGTGA 2014-07-19 2014-07-19
snp_cf0067001009144 TM8 Y AGAAGCTGAACTTCGTGCTGTCGGACAGAG GGCCAGCGCAGGGGTGAGCATGTGGTGTGA 2014-07-19 2014-07-19
snp_cf0063001027916 TM4 Y AGAAGCTGAACTTCGTGCTGTCGGACAGAG GGCCAGCGCAGGGGTGAGCATGTGGTGTGA 2014-07-19 2014-07-19
snp_cf0056001322818 LUPWRUS00001 Y AGAAGCTGAACTTCGTGCTGTCGGACAGAG GGCCAGCGCAGGGGTGAGCATGTGGTGTGA 2014-07-19 2014-07-19
snp_cf0034001231936 ISW Y AGAAGCTGAACTTCGTGCTGTCGGACAGAG GGCCAGCGCAGGGGTGAGCATGTGGTGTGA 2014-07-19 2014-07-19
snp_cf0073001057222 YJ4 Y AGAAGCTGAACTTCGTGCTGTCGGACAGAG GGCCAGCGCAGGGGTGAGCATGTGGTGTGA 2014-07-19 2014-07-19
snp_cf0060001035652 TM1 Y AGAAGCTGAACTTCGTGCTGTCGGACAGAG GGCCAGCGCAGGGGTGAGCATGTGGTGTGA 2014-07-19 2014-07-19
6.Fasta Information
CACGCTGCGC ATCAGCCCGG AGAAGCTGAA CTTCGTGCTG TCGGACAGAG
Y
GGCCAGCGCA GGGGTGAGCA TGTGGTGTGA GCTGGAGCAG GTGAGAGGAG