e.g. 1:1246..9423
SNP Detail For snp_cf0016001038577    [See in GBrowse]
1.General Information
SNP ID: snp_cf0016001038577
Organism: Canis familiaris
Individual: DQ8
Create time: 2014-07-19
Last update: 2014-07-19
2.Allele Information
Platform: SOLEXA
Method: sequence
SNP Class: snp
Genotype: K
5'flank: TCCGAGGGCACGCAACTGTTCATCTCCAGG
3'flank: CCCCCTCAGTCACCATCATCCTCAGTGGCT
3.Reference Map information
Chrom Position Reference DQ8
Chr16 139757 G K
4.Gene information
Gene model(s)
Gene ID Position in Gene Strands Gene Allele Location
ENSCAFG00000014734 16032 + G CDS
Transcript Protein
SNP to transcript Accession Position in Transcript Allele change Accession Position in Protein Residue change
+ ENSCAFT00000042831 1954 GCC => TCC ENSCAFP00000040839 652 A => S
+ ENSCAFT00000023399 1462 GCC => TCC ENSCAFP00000021730 488 A => S
5.SNPs of other individuals in this position
SNP_ID Individual Genotype 5' Near Seq 30 bp 3' Near Seq 30 bp Create time Last update time
snp_cf0010001043223 DQ2 K TCCGAGGGCACGCAACTGTTCATCTCCAGG CCCCCTCAGTCACCATCATCCTCAGTGGCT 2014-07-19 2014-07-19
snp_cf0012001047853 DQ4 K TCCGAGGGCACGCAACTGTTCATCTCCAGG CCCCCTCAGTCACCATCATCCTCAGTGGCT 2014-07-19 2014-07-19
snp_cf0024000845832 GS10 K TCCGAGGGCACGCAACTGTTCATCTCCAGG CCCCCTCAGTCACCATCATCCTCAGTGGCT 2014-07-19 2014-07-19
snp_cf0036000825303 KM1 K TCCGAGGGCACGCAACTGTTCATCTCCAGG CCCCCTCAGTCACCATCATCCTCAGTGGCT 2014-07-19 2014-07-19
snp_cf0025000803091 GS1 K TCCGAGGGCACGCAACTGTTCATCTCCAGG CCCCCTCAGTCACCATCATCCTCAGTGGCT 2014-07-19 2014-07-19
snp_cf0038000798787 KM3 K TCCGAGGGCACGCAACTGTTCATCTCCAGG CCCCCTCAGTCACCATCATCCTCAGTGGCT 2014-07-19 2014-07-19
snp_cf0028000768082 GS4 K TCCGAGGGCACGCAACTGTTCATCTCCAGG CCCCCTCAGTCACCATCATCCTCAGTGGCT 2014-07-19 2014-07-19
snp_cf0020001032303 FAMBTIM00001 K TCCGAGGGCACGCAACTGTTCATCTCCAGG CCCCCTCAGTCACCATCATCCTCAGTGGCT 2014-07-19 2014-07-19
snp_cf0075001070653 YJ6 K TCCGAGGGCACGCAACTGTTCATCTCCAGG CCCCCTCAGTCACCATCATCCTCAGTGGCT 2014-07-19 2014-07-19
snp_cf0058001306931 LUPWRUS00003 K TCCGAGGGCACGCAACTGTTCATCTCCAGG CCCCCTCAGTCACCATCATCCTCAGTGGCT 2014-07-19 2014-07-19
snp_cf0001000434685 solidGW1 K TCCGAGGGCACGCAACTGTTCATCTCCAGG CCCCCTCAGTCACCATCATCCTCAGTGGCT 2014-08-01 2014-08-01
snp_cf0011001055667 DQ3 K TCCGAGGGCACGCAACTGTTCATCTCCAGG CCCCCTCAGTCACCATCATCCTCAGTGGCT 2014-07-19 2014-07-19
snp_cf0013001008611 DQ5 K TCCGAGGGCACGCAACTGTTCATCTCCAGG CCCCCTCAGTCACCATCATCCTCAGTGGCT 2014-07-19 2014-07-19
snp_cf0073001057370 YJ4 K TCCGAGGGCACGCAACTGTTCATCTCCAGG CCCCCTCAGTCACCATCATCCTCAGTGGCT 2014-07-19 2014-07-19
snp_cf0014001026577 DQ6 K TCCGAGGGCACGCAACTGTTCATCTCCAGG CCCCCTCAGTCACCATCATCCTCAGTGGCT 2014-07-19 2014-07-19
snp_cf0005001280031 CHW K TCCGAGGGCACGCAACTGTTCATCTCCAGG CCCCCTCAGTCACCATCATCCTCAGTGGCT 2014-07-19 2014-07-19
snp_cf0062001045403 TM3 K TCCGAGGGCACGCAACTGTTCATCTCCAGG CCCCCTCAGTCACCATCATCCTCAGTGGCT 2014-07-19 2014-07-19
snp_cf0044000923227 KM9 K TCCGAGGGCACGCAACTGTTCATCTCCAGG CCCCCTCAGTCACCATCATCCTCAGTGGCT 2014-07-19 2014-07-19
snp_cf0040000920946 KM5 K TCCGAGGGCACGCAACTGTTCATCTCCAGG CCCCCTCAGTCACCATCATCCTCAGTGGCT 2014-07-19 2014-07-19
snp_cf0042001073497 KM7 K TCCGAGGGCACGCAACTGTTCATCTCCAGG CCCCCTCAGTCACCATCATCCTCAGTGGCT 2014-07-19 2014-07-19
snp_cf0064001051593 TM5 K TCCGAGGGCACGCAACTGTTCATCTCCAGG CCCCCTCAGTCACCATCATCCTCAGTGGCT 2014-07-19 2014-07-19
snp_cf0006001210213 CRW K TCCGAGGGCACGCAACTGTTCATCTCCAGG CCCCCTCAGTCACCATCATCCTCAGTGGCT 2014-07-19 2014-07-19
snp_cf0068001005309 TM9 K TCCGAGGGCACGCAACTGTTCATCTCCAGG CCCCCTCAGTCACCATCATCCTCAGTGGCT 2014-07-19 2014-07-19
snp_cf0023000992106 FAMICHN00003 K TCCGAGGGCACGCAACTGTTCATCTCCAGG CCCCCTCAGTCACCATCATCCTCAGTGGCT 2014-07-19 2014-07-19
snp_cf0071001064970 YJ2 K TCCGAGGGCACGCAACTGTTCATCTCCAGG CCCCCTCAGTCACCATCATCCTCAGTGGCT 2014-07-19 2014-07-19
snp_cf0033000811304 GS9 K TCCGAGGGCACGCAACTGTTCATCTCCAGG CCCCCTCAGTCACCATCATCCTCAGTGGCT 2014-07-19 2014-07-19
snp_cf0052001017738 LJ7 K TCCGAGGGCACGCAACTGTTCATCTCCAGG CCCCCTCAGTCACCATCATCCTCAGTGGCT 2014-07-19 2014-07-19
snp_cf0030000829894 GS6 K TCCGAGGGCACGCAACTGTTCATCTCCAGG CCCCCTCAGTCACCATCATCCTCAGTGGCT 2014-07-19 2014-07-19
snp_cf0027000808237 GS3 K TCCGAGGGCACGCAACTGTTCATCTCCAGG CCCCCTCAGTCACCATCATCCTCAGTGGCT 2014-07-19 2014-07-19
snp_cf0057001260865 LUPWRUS00002 K TCCGAGGGCACGCAACTGTTCATCTCCAGG CCCCCTCAGTCACCATCATCCTCAGTGGCT 2014-07-19 2014-07-19
snp_cf0037000884387 KM2 K TCCGAGGGCACGCAACTGTTCATCTCCAGG CCCCCTCAGTCACCATCATCCTCAGTGGCT 2014-07-19 2014-07-19
snp_cf0053001016185 LJ8 K TCCGAGGGCACGCAACTGTTCATCTCCAGG CCCCCTCAGTCACCATCATCCTCAGTGGCT 2014-07-19 2014-07-19
snp_cf0056001322955 LUPWRUS00001 K TCCGAGGGCACGCAACTGTTCATCTCCAGG CCCCCTCAGTCACCATCATCCTCAGTGGCT 2014-07-19 2014-07-19
snp_cf0032000801396 GS8 K TCCGAGGGCACGCAACTGTTCATCTCCAGG CCCCCTCAGTCACCATCATCCTCAGTGGCT 2014-07-19 2014-07-19
snp_cf0072001071589 YJ3 K TCCGAGGGCACGCAACTGTTCATCTCCAGG CCCCCTCAGTCACCATCATCCTCAGTGGCT 2014-07-19 2014-07-19
snp_cf0034001232067 ISW K TCCGAGGGCACGCAACTGTTCATCTCCAGG CCCCCTCAGTCACCATCATCCTCAGTGGCT 2014-07-19 2014-07-19
snp_cf0065001014084 TM6 K TCCGAGGGCACGCAACTGTTCATCTCCAGG CCCCCTCAGTCACCATCATCCTCAGTGGCT 2014-07-19 2014-07-19
snp_cf0066001064548 TM7 K TCCGAGGGCACGCAACTGTTCATCTCCAGG CCCCCTCAGTCACCATCATCCTCAGTGGCT 2014-07-19 2014-07-19
snp_cf0067001009273 TM8 K TCCGAGGGCACGCAACTGTTCATCTCCAGG CCCCCTCAGTCACCATCATCCTCAGTGGCT 2014-07-19 2014-07-19
snp_cf0063001028064 TM4 K TCCGAGGGCACGCAACTGTTCATCTCCAGG CCCCCTCAGTCACCATCATCCTCAGTGGCT 2014-07-19 2014-07-19
snp_cf0019000807406 FAMBGSD00001 K TCCGAGGGCACGCAACTGTTCATCTCCAGG CCCCCTCAGTCACCATCATCCTCAGTGGCT 2014-07-19 2014-07-19
snp_cf0070001099321 YJ1 K TCCGAGGGCACGCAACTGTTCATCTCCAGG CCCCCTCAGTCACCATCATCCTCAGTGGCT 2014-07-19 2014-07-19
snp_cf0007000883842 Dingo K TCCGAGGGCACGCAACTGTTCATCTCCAGG CCCCCTCAGTCACCATCATCCTCAGTGGCT 2014-07-19 2014-07-19
snp_cf0049001050473 LJ4 K TCCGAGGGCACGCAACTGTTCATCTCCAGG CCCCCTCAGTCACCATCATCCTCAGTGGCT 2014-07-19 2014-07-19
snp_cf0035001011382 KM10 K TCCGAGGGCACGCAACTGTTCATCTCCAGG CCCCCTCAGTCACCATCATCCTCAGTGGCT 2014-07-19 2014-07-19
snp_cf0055001308852 LUPWCHN00001 K TCCGAGGGCACGCAACTGTTCATCTCCAGG CCCCCTCAGTCACCATCATCCTCAGTGGCT 2014-07-19 2014-07-19
snp_cf0069001076108 YJ10 K TCCGAGGGCACGCAACTGTTCATCTCCAGG CCCCCTCAGTCACCATCATCCTCAGTGGCT 2014-07-19 2014-07-19
snp_cf0059001051874 TM10 K TCCGAGGGCACGCAACTGTTCATCTCCAGG CCCCCTCAGTCACCATCATCCTCAGTGGCT 2014-07-19 2014-07-19
snp_cf0018000867920 FAMBBEM00001 K TCCGAGGGCACGCAACTGTTCATCTCCAGG CCCCCTCAGTCACCATCATCCTCAGTGGCT 2014-07-19 2014-07-19
snp_cf0039000836293 KM4 K TCCGAGGGCACGCAACTGTTCATCTCCAGG CCCCCTCAGTCACCATCATCCTCAGTGGCT 2014-07-19 2014-07-19
snp_cf0051001043549 LJ6 K TCCGAGGGCACGCAACTGTTCATCTCCAGG CCCCCTCAGTCACCATCATCCTCAGTGGCT 2014-07-19 2014-07-19
snp_cf0043000867885 KM8 K TCCGAGGGCACGCAACTGTTCATCTCCAGG CCCCCTCAGTCACCATCATCCTCAGTGGCT 2014-07-19 2014-07-19
snp_cf0017001057856 DQ9 K TCCGAGGGCACGCAACTGTTCATCTCCAGG CCCCCTCAGTCACCATCATCCTCAGTGGCT 2014-07-19 2014-07-19
snp_cf0060001035795 TM1 K TCCGAGGGCACGCAACTGTTCATCTCCAGG CCCCCTCAGTCACCATCATCCTCAGTGGCT 2014-07-19 2014-07-19
snp_cf0076001075949 YJ7 K TCCGAGGGCACGCAACTGTTCATCTCCAGG CCCCCTCAGTCACCATCATCCTCAGTGGCT 2014-07-19 2014-07-19
snp_cf0031000820252 GS7 K TCCGAGGGCACGCAACTGTTCATCTCCAGG CCCCCTCAGTCACCATCATCCTCAGTGGCT 2014-07-19 2014-07-19
snp_cf0074001060491 YJ5 K TCCGAGGGCACGCAACTGTTCATCTCCAGG CCCCCTCAGTCACCATCATCCTCAGTGGCT 2014-07-19 2014-07-19
snp_cf0061001055708 TM2 K TCCGAGGGCACGCAACTGTTCATCTCCAGG CCCCCTCAGTCACCATCATCCTCAGTGGCT 2014-07-19 2014-07-19
snp_cf0048000994958 LJ3 T TCCGAGGGCACGCAACTGTTCATCTCCAGG CCCCCTCAGTCACCATCATCCTCAGTGGCT 2014-07-19 2014-07-19
snp_cf0029000749401 GS5 K TCCGAGGGCACGCAACTGTTCATCTCCAGG CCCCCTCAGTCACCATCATCCTCAGTGGCT 2014-07-19 2014-07-19
snp_cf0004000866319 Basenji K TCCGAGGGCACGCAACTGTTCATCTCCAGG CCCCCTCAGTCACCATCATCCTCAGTGGCT 2014-07-19 2014-07-19
snp_cf0021000986631 FAMICHN00001 K TCCGAGGGCACGCAACTGTTCATCTCCAGG CCCCCTCAGTCACCATCATCCTCAGTGGCT 2014-07-19 2014-07-19
snp_cf0026000806502 GS2 K TCCGAGGGCACGCAACTGTTCATCTCCAGG CCCCCTCAGTCACCATCATCCTCAGTGGCT 2014-07-19 2014-07-19
snp_cf0009001051862 DQ1 K TCCGAGGGCACGCAACTGTTCATCTCCAGG CCCCCTCAGTCACCATCATCCTCAGTGGCT 2014-07-19 2014-07-19
snp_cf0015001045598 DQ7 K TCCGAGGGCACGCAACTGTTCATCTCCAGG CCCCCTCAGTCACCATCATCCTCAGTGGCT 2014-07-19 2014-07-19
snp_cf0041001036946 KM6 K TCCGAGGGCACGCAACTGTTCATCTCCAGG CCCCCTCAGTCACCATCATCCTCAGTGGCT 2014-07-19 2014-07-19
snp_cf0008001033012 DQ10 K TCCGAGGGCACGCAACTGTTCATCTCCAGG CCCCCTCAGTCACCATCATCCTCAGTGGCT 2014-07-19 2014-07-19
snp_cf0077001053512 YJ8 K TCCGAGGGCACGCAACTGTTCATCTCCAGG CCCCCTCAGTCACCATCATCCTCAGTGGCT 2014-07-19 2014-07-19
snp_cf0078001065337 YJ9 K TCCGAGGGCACGCAACTGTTCATCTCCAGG CCCCCTCAGTCACCATCATCCTCAGTGGCT 2014-07-19 2014-07-19
6.Fasta Information
GGGCCCCAGT CAGCGTCATC TCCGAGGGCA CGCAACTGTT CATCTCCAGG
K
CCCCCTCAGT CACCATCATC CTCAGTGGCT CCCAGTCCTA TGACCCAGAC