e.g. 1:1246..9423
SNP Detail For snp_cf0016001038672    [See in GBrowse]
1.General Information
SNP ID: snp_cf0016001038672
Organism: Canis familiaris
Individual: DQ8
Create time: 2014-07-19
Last update: 2014-07-19
NCBI rs link rs8861525  
2.Allele Information
Platform: SOLEXA
Method: sequence
SNP Class: snp
Genotype: K
5'flank: CCCGTGGCCGTGGAGTTTGGGGAGGAAGGC
3'flank: GCCTGGTGAGGGCCCTGCAAGCCCCCGGGG
3.Reference Map information
Chrom Position Reference DQ8
Chr16 163882 G K
4.Gene information
Gene model(s)
Gene ID Position in Gene Strands Gene Allele Location
ENSCAFG00000014734 40157 + G CDS
Transcript Protein
SNP to transcript Accession Position in Transcript Allele change Accession Position in Protein Residue change
+ ENSCAFT00000042831 4270 GGC => TGC ENSCAFP00000040839 1424 G => C
+ ENSCAFT00000023399 3706 GGC => TGC ENSCAFP00000021730 1236 G => C
5.SNPs of other individuals in this position
SNP_ID Individual Genotype 5' Near Seq 30 bp 3' Near Seq 30 bp Create time Last update time
snp_cf0030000829985 GS6 K CCCGTGGCCGTGGAGTTTGGGGAGGAAGGC GCCTGGTGAGGGCCCTGCAAGCCCCCGGGG 2014-07-19 2014-07-19
snp_cf0019000807494 FAMBGSD00001 K CCCGTGGCCGTGGAGTTTGGGGAGGAAGGC GCCTGGTGAGGGCCCTGCAAGCCCCCGGGG 2014-07-19 2014-07-19
snp_cf0027000808329 GS3 K CCCGTGGCCGTGGAGTTTGGGGAGGAAGGC GCCTGGTGAGGGCCCTGCAAGCCCCCGGGG 2014-07-19 2014-07-19
snp_cf0069001076202 YJ10 K CCCGTGGCCGTGGAGTTTGGGGAGGAAGGC GCCTGGTGAGGGCCCTGCAAGCCCCCGGGG 2014-07-19 2014-07-19
snp_cf0040000921038 KM5 K CCCGTGGCCGTGGAGTTTGGGGAGGAAGGC GCCTGGTGAGGGCCCTGCAAGCCCCCGGGG 2014-07-19 2014-07-19
snp_cf0061001055795 TM2 K CCCGTGGCCGTGGAGTTTGGGGAGGAAGGC GCCTGGTGAGGGCCCTGCAAGCCCCCGGGG 2014-07-19 2014-07-19
snp_cf0029000749490 GS5 T CCCGTGGCCGTGGAGTTTGGGGAGGAAGGC GCCTGGTGAGGGCCCTGCAAGCCCCCGGGG 2014-07-19 2014-07-19
snp_cf0003000583762 dbSNP139 T CCCGTGGCCGTGGAGTTTGGGGAGGAAGGC GCCTGGTGAGGGCCCTGCAAGCCCCCGGGG 2014-07-19 2014-07-19
snp_cf0025000803179 GS1 K CCCGTGGCCGTGGAGTTTGGGGAGGAAGGC GCCTGGTGAGGGCCCTGCAAGCCCCCGGGG 2014-07-19 2014-07-19
snp_cf0008001033104 DQ10 K CCCGTGGCCGTGGAGTTTGGGGAGGAAGGC GCCTGGTGAGGGCCCTGCAAGCCCCCGGGG 2014-07-19 2014-07-19
snp_cf0071001065062 YJ2 K CCCGTGGCCGTGGAGTTTGGGGAGGAAGGC GCCTGGTGAGGGCCCTGCAAGCCCCCGGGG 2014-07-19 2014-07-19
snp_cf0032000801477 GS8 K CCCGTGGCCGTGGAGTTTGGGGAGGAAGGC GCCTGGTGAGGGCCCTGCAAGCCCCCGGGG 2014-07-19 2014-07-19
snp_cf0043000867978 KM8 K CCCGTGGCCGTGGAGTTTGGGGAGGAAGGC GCCTGGTGAGGGCCCTGCAAGCCCCCGGGG 2014-07-19 2014-07-19
snp_cf0057001260946 LUPWRUS00002 K CCCGTGGCCGTGGAGTTTGGGGAGGAAGGC GCCTGGTGAGGGCCCTGCAAGCCCCCGGGG 2014-07-19 2014-07-19
snp_cf0056001323046 LUPWRUS00001 K CCCGTGGCCGTGGAGTTTGGGGAGGAAGGC GCCTGGTGAGGGCCCTGCAAGCCCCCGGGG 2014-07-19 2014-07-19
snp_cf0023000992195 FAMICHN00003 K CCCGTGGCCGTGGAGTTTGGGGAGGAAGGC GCCTGGTGAGGGCCCTGCAAGCCCCCGGGG 2014-07-19 2014-07-19
snp_cf0073001057465 YJ4 K CCCGTGGCCGTGGAGTTTGGGGAGGAAGGC GCCTGGTGAGGGCCCTGCAAGCCCCCGGGG 2014-07-19 2014-07-19
snp_cf0078001065436 YJ9 K CCCGTGGCCGTGGAGTTTGGGGAGGAAGGC GCCTGGTGAGGGCCCTGCAAGCCCCCGGGG 2014-07-19 2014-07-19
snp_cf0062001045499 TM3 K CCCGTGGCCGTGGAGTTTGGGGAGGAAGGC GCCTGGTGAGGGCCCTGCAAGCCCCCGGGG 2014-07-19 2014-07-19
snp_cf0033000811393 GS9 K CCCGTGGCCGTGGAGTTTGGGGAGGAAGGC GCCTGGTGAGGGCCCTGCAAGCCCCCGGGG 2014-07-19 2014-07-19
snp_cf0060001035882 TM1 K CCCGTGGCCGTGGAGTTTGGGGAGGAAGGC GCCTGGTGAGGGCCCTGCAAGCCCCCGGGG 2014-07-19 2014-07-19
snp_cf0026000806595 GS2 K CCCGTGGCCGTGGAGTTTGGGGAGGAAGGC GCCTGGTGAGGGCCCTGCAAGCCCCCGGGG 2014-07-19 2014-07-19
snp_cf0077001053609 YJ8 K CCCGTGGCCGTGGAGTTTGGGGAGGAAGGC GCCTGGTGAGGGCCCTGCAAGCCCCCGGGG 2014-07-19 2014-07-19
snp_cf0021000986720 FAMICHN00001 K CCCGTGGCCGTGGAGTTTGGGGAGGAAGGC GCCTGGTGAGGGCCCTGCAAGCCCCCGGGG 2014-07-19 2014-07-19
snp_cf0042001073590 KM7 K CCCGTGGCCGTGGAGTTTGGGGAGGAAGGC GCCTGGTGAGGGCCCTGCAAGCCCCCGGGG 2014-07-19 2014-07-19
snp_cf0049001050565 LJ4 K CCCGTGGCCGTGGAGTTTGGGGAGGAAGGC GCCTGGTGAGGGCCCTGCAAGCCCCCGGGG 2014-07-19 2014-07-19
snp_cf0024000845924 GS10 K CCCGTGGCCGTGGAGTTTGGGGAGGAAGGC GCCTGGTGAGGGCCCTGCAAGCCCCCGGGG 2014-07-19 2014-07-19
snp_cf0038000798878 KM3 K CCCGTGGCCGTGGAGTTTGGGGAGGAAGGC GCCTGGTGAGGGCCCTGCAAGCCCCCGGGG 2014-07-19 2014-07-19
snp_cf0074001060588 YJ5 K CCCGTGGCCGTGGAGTTTGGGGAGGAAGGC GCCTGGTGAGGGCCCTGCAAGCCCCCGGGG 2014-07-19 2014-07-19
snp_cf0063001028158 TM4 K CCCGTGGCCGTGGAGTTTGGGGAGGAAGGC GCCTGGTGAGGGCCCTGCAAGCCCCCGGGG 2014-07-19 2014-07-19
snp_cf0018000868004 FAMBBEM00001 K CCCGTGGCCGTGGAGTTTGGGGAGGAAGGC GCCTGGTGAGGGCCCTGCAAGCCCCCGGGG 2014-07-19 2014-07-19
snp_cf0012001047940 DQ4 K CCCGTGGCCGTGGAGTTTGGGGAGGAAGGC GCCTGGTGAGGGCCCTGCAAGCCCCCGGGG 2014-07-19 2014-07-19
snp_cf0020001032395 FAMBTIM00001 K CCCGTGGCCGTGGAGTTTGGGGAGGAAGGC GCCTGGTGAGGGCCCTGCAAGCCCCCGGGG 2014-07-19 2014-07-19
snp_cf0037000884481 KM2 K CCCGTGGCCGTGGAGTTTGGGGAGGAAGGC GCCTGGTGAGGGCCCTGCAAGCCCCCGGGG 2014-07-19 2014-07-19
snp_cf0075001070746 YJ6 K CCCGTGGCCGTGGAGTTTGGGGAGGAAGGC GCCTGGTGAGGGCCCTGCAAGCCCCCGGGG 2014-07-19 2014-07-19
snp_cf0028000768171 GS4 K CCCGTGGCCGTGGAGTTTGGGGAGGAAGGC GCCTGGTGAGGGCCCTGCAAGCCCCCGGGG 2014-07-19 2014-07-19
snp_cf0039000836389 KM4 K CCCGTGGCCGTGGAGTTTGGGGAGGAAGGC GCCTGGTGAGGGCCCTGCAAGCCCCCGGGG 2014-07-19 2014-07-19
snp_cf0076001076044 YJ7 K CCCGTGGCCGTGGAGTTTGGGGAGGAAGGC GCCTGGTGAGGGCCCTGCAAGCCCCCGGGG 2014-07-19 2014-07-19
snp_cf0035001011469 KM10 K CCCGTGGCCGTGGAGTTTGGGGAGGAAGGC GCCTGGTGAGGGCCCTGCAAGCCCCCGGGG 2014-07-19 2014-07-19
snp_cf0004000866403 Basenji T CCCGTGGCCGTGGAGTTTGGGGAGGAAGGC GCCTGGTGAGGGCCCTGCAAGCCCCCGGGG 2014-07-19 2014-07-19
snp_cf0072001071684 YJ3 K CCCGTGGCCGTGGAGTTTGGGGAGGAAGGC GCCTGGTGAGGGCCCTGCAAGCCCCCGGGG 2014-07-19 2014-07-19
snp_cf0066001064645 TM7 K CCCGTGGCCGTGGAGTTTGGGGAGGAAGGC GCCTGGTGAGGGCCCTGCAAGCCCCCGGGG 2014-07-19 2014-07-19
snp_cf0064001051686 TM5 K CCCGTGGCCGTGGAGTTTGGGGAGGAAGGC GCCTGGTGAGGGCCCTGCAAGCCCCCGGGG 2014-07-19 2014-07-19
snp_cf0017001057943 DQ9 K CCCGTGGCCGTGGAGTTTGGGGAGGAAGGC GCCTGGTGAGGGCCCTGCAAGCCCCCGGGG 2014-07-19 2014-07-19
snp_cf0036000825390 KM1 K CCCGTGGCCGTGGAGTTTGGGGAGGAAGGC GCCTGGTGAGGGCCCTGCAAGCCCCCGGGG 2014-07-19 2014-07-19
snp_cf0070001099421 YJ1 K CCCGTGGCCGTGGAGTTTGGGGAGGAAGGC GCCTGGTGAGGGCCCTGCAAGCCCCCGGGG 2014-07-19 2014-07-19
snp_cf0031000820341 GS7 K CCCGTGGCCGTGGAGTTTGGGGAGGAAGGC GCCTGGTGAGGGCCCTGCAAGCCCCCGGGG 2014-07-19 2014-07-19
snp_cf0041001037038 KM6 K CCCGTGGCCGTGGAGTTTGGGGAGGAAGGC GCCTGGTGAGGGCCCTGCAAGCCCCCGGGG 2014-07-19 2014-07-19
snp_cf0046000965695 LJ1 T CCCGTGGCCGTGGAGTTTGGGGAGGAAGGC GCCTGGTGAGGGCCCTGCAAGCCCCCGGGG 2014-07-19 2014-07-19
6.Fasta Information
GCGGCTGGCG GCTGAGGGCG CCCGTGGCCG TGGAGTTTGG GGAGGAAGGC
K
GCCTGGTGAG GGCCCTGCAA GCCCCCGGGG TCGCGCCGGC CGCGCTGACC