e.g. 1:1246..9423
SNP Detail For snp_cf0017000523147    [See in GBrowse]
1.General Information
SNP ID: snp_cf0017000523147
Organism: Canis familiaris
Individual: DQ9
Create time: 2014-07-19
Last update: 2014-07-19
NCBI rs link rs9056818  
2.Allele Information
Platform: SOLEXA
Method: sequence
SNP Class: snp
Genotype: T
5'flank: GGGCTATCGGAGGGGCGGGGCCTGCGTACG
3'flank: TCGTGCGTGAGGGCTAGCGCGGCGCCGATG
3.Reference Map information
Chrom Position Reference DQ9
Chr12 332051 C T
4.Gene information
Gene model(s)
Gene ID Position in Gene Strands Gene Allele Location
ENSCAFG00000000394 228 + C CDS
Transcript Protein
SNP to transcript Accession Position in Transcript Allele change Accession Position in Protein Residue change
+ ENSCAFT00000000624 228 CGC => CGT ENSCAFP00000000570 76 R => R
5.SNPs of other individuals in this position
SNP_ID Individual Genotype 5' Near Seq 30 bp 3' Near Seq 30 bp Create time Last update time
snp_cf0003000275908 dbSNP139 T GGGCTATCGGAGGGGCGGGGCCTGCGTACG TCGTGCGTGAGGGCTAGCGCGGCGCCGATG 2014-07-19 2014-07-19
snp_cf0075000528169 YJ6 Y GGGCTATCGGAGGGGCGGGGCCTGCGTACG TCGTGCGTGAGGGCTAGCGCGGCGCCGATG 2014-07-19 2014-07-19
snp_cf0027000386558 GS3 Y GGGCTATCGGAGGGGCGGGGCCTGCGTACG TCGTGCGTGAGGGCTAGCGCGGCGCCGATG 2014-07-19 2014-07-19
snp_cf0041000482794 KM6 Y GGGCTATCGGAGGGGCGGGGCCTGCGTACG TCGTGCGTGAGGGCTAGCGCGGCGCCGATG 2014-07-19 2014-07-19
snp_cf0042000497178 KM7 Y GGGCTATCGGAGGGGCGGGGCCTGCGTACG TCGTGCGTGAGGGCTAGCGCGGCGCCGATG 2014-07-19 2014-07-19
snp_cf0016000509313 DQ8 T GGGCTATCGGAGGGGCGGGGCCTGCGTACG TCGTGCGTGAGGGCTAGCGCGGCGCCGATG 2014-07-19 2014-07-19
snp_cf0005000627024 CHW T GGGCTATCGGAGGGGCGGGGCCTGCGTACG TCGTGCGTGAGGGCTAGCGCGGCGCCGATG 2014-07-19 2014-07-19
snp_cf0019000386198 FAMBGSD00001 Y GGGCTATCGGAGGGGCGGGGCCTGCGTACG TCGTGCGTGAGGGCTAGCGCGGCGCCGATG 2014-07-19 2014-07-19
snp_cf0057000631037 LUPWRUS00002 Y GGGCTATCGGAGGGGCGGGGCCTGCGTACG TCGTGCGTGAGGGCTAGCGCGGCGCCGATG 2014-07-19 2014-07-19
snp_cf0011000511476 DQ3 Y GGGCTATCGGAGGGGCGGGGCCTGCGTACG TCGTGCGTGAGGGCTAGCGCGGCGCCGATG 2014-07-19 2014-07-19
snp_cf0031000390006 GS7 Y GGGCTATCGGAGGGGCGGGGCCTGCGTACG TCGTGCGTGAGGGCTAGCGCGGCGCCGATG 2014-07-19 2014-07-19
snp_cf0067000502756 TM8 Y GGGCTATCGGAGGGGCGGGGCCTGCGTACG TCGTGCGTGAGGGCTAGCGCGGCGCCGATG 2014-07-19 2014-07-19
snp_cf0052000492860 LJ7 T GGGCTATCGGAGGGGCGGGGCCTGCGTACG TCGTGCGTGAGGGCTAGCGCGGCGCCGATG 2014-07-19 2014-07-19
snp_cf0021000482358 FAMICHN00001 Y GGGCTATCGGAGGGGCGGGGCCTGCGTACG TCGTGCGTGAGGGCTAGCGCGGCGCCGATG 2014-07-19 2014-07-19
snp_cf0056000652108 LUPWRUS00001 Y GGGCTATCGGAGGGGCGGGGCCTGCGTACG TCGTGCGTGAGGGCTAGCGCGGCGCCGATG 2014-07-19 2014-07-19
snp_cf0034000617229 ISW T GGGCTATCGGAGGGGCGGGGCCTGCGTACG TCGTGCGTGAGGGCTAGCGCGGCGCCGATG 2014-07-19 2014-07-19
snp_cf0023000476264 FAMICHN00003 Y GGGCTATCGGAGGGGCGGGGCCTGCGTACG TCGTGCGTGAGGGCTAGCGCGGCGCCGATG 2014-07-19 2014-07-19
snp_cf0020000500169 FAMBTIM00001 Y GGGCTATCGGAGGGGCGGGGCCTGCGTACG TCGTGCGTGAGGGCTAGCGCGGCGCCGATG 2014-07-19 2014-07-19
6.Fasta Information
CATCGCGGGC GCCCGGGGCG GGGCTATCGG AGGGGCGGGG CCTGCGTACG
T
TCGTGCGTGA GGGCTAGCGC GGCGCCGATG GCTGGGCCGG TGAAGGACCG