e.g. 1:1246..9423
SNP Detail For snp_cf0017000523363    [See in GBrowse]
1.General Information
SNP ID: snp_cf0017000523363
Organism: Canis familiaris
Individual: DQ9
Create time: 2014-07-19
Last update: 2014-07-19
2.Allele Information
Platform: SOLEXA
Method: sequence
SNP Class: snp
Genotype: C
5'flank: CCTGAGGTGTTTCCGTTTTCTACGCTTCTT
3'flank: TGGAGACTGCTCCCAGTTCTACCTACGGTC
3.Reference Map information
Chrom Position Reference DQ9
Chr12 475801 T C
4.Gene information
Gene model(s)
Gene ID Position in Gene Strands Gene Allele Location
ENSCAFG00000000427 2015 - T CDS
Transcript Protein
SNP to transcript Accession Position in Transcript Allele change Accession Position in Protein Residue change
- ENSCAFT00000000685 357 CAA => CAG ENSCAFP00000000629 119 Q => Q
5.SNPs of other individuals in this position
SNP_ID Individual Genotype 5' Near Seq 30 bp 3' Near Seq 30 bp Create time Last update time
snp_cf0008000502159 DQ10 C CCTGAGGTGTTTCCGTTTTCTACGCTTCTT TGGAGACTGCTCCCAGTTCTACCTACGGTC 2014-07-19 2014-07-19
snp_cf0064000514951 TM5 C CCTGAGGTGTTTCCGTTTTCTACGCTTCTT TGGAGACTGCTCCCAGTTCTACCTACGGTC 2014-07-19 2014-07-19
snp_cf0072000524863 YJ3 C CCTGAGGTGTTTCCGTTTTCTACGCTTCTT TGGAGACTGCTCCCAGTTCTACCTACGGTC 2014-07-19 2014-07-19
snp_cf0053000493141 LJ8 C CCTGAGGTGTTTCCGTTTTCTACGCTTCTT TGGAGACTGCTCCCAGTTCTACCTACGGTC 2014-07-19 2014-07-19
snp_cf0028000383888 GS4 C CCTGAGGTGTTTCCGTTTTCTACGCTTCTT TGGAGACTGCTCCCAGTTCTACCTACGGTC 2014-07-19 2014-07-19
snp_cf0007000424000 Dingo C CCTGAGGTGTTTCCGTTTTCTACGCTTCTT TGGAGACTGCTCCCAGTTCTACCTACGGTC 2014-07-19 2014-07-19
snp_cf0024000419595 GS10 C CCTGAGGTGTTTCCGTTTTCTACGCTTCTT TGGAGACTGCTCCCAGTTCTACCTACGGTC 2014-07-19 2014-07-19
snp_cf0019000386487 FAMBGSD00001 C CCTGAGGTGTTTCCGTTTTCTACGCTTCTT TGGAGACTGCTCCCAGTTCTACCTACGGTC 2014-07-19 2014-07-19
snp_cf0012000504395 DQ4 C CCTGAGGTGTTTCCGTTTTCTACGCTTCTT TGGAGACTGCTCCCAGTTCTACCTACGGTC 2014-07-19 2014-07-19
snp_cf0059000515986 TM10 C CCTGAGGTGTTTCCGTTTTCTACGCTTCTT TGGAGACTGCTCCCAGTTCTACCTACGGTC 2014-07-19 2014-07-19
snp_cf0050000457848 LJ5 Y CCTGAGGTGTTTCCGTTTTCTACGCTTCTT TGGAGACTGCTCCCAGTTCTACCTACGGTC 2014-07-19 2014-07-19
snp_cf0033000406247 GS9 C CCTGAGGTGTTTCCGTTTTCTACGCTTCTT TGGAGACTGCTCCCAGTTCTACCTACGGTC 2014-07-19 2014-07-19
snp_cf0026000389912 GS2 C CCTGAGGTGTTTCCGTTTTCTACGCTTCTT TGGAGACTGCTCCCAGTTCTACCTACGGTC 2014-07-19 2014-07-19
snp_cf0037000412204 KM2 C CCTGAGGTGTTTCCGTTTTCTACGCTTCTT TGGAGACTGCTCCCAGTTCTACCTACGGTC 2014-07-19 2014-07-19
snp_cf0030000395536 GS6 C CCTGAGGTGTTTCCGTTTTCTACGCTTCTT TGGAGACTGCTCCCAGTTCTACCTACGGTC 2014-07-19 2014-07-19
snp_cf0034000617484 ISW C CCTGAGGTGTTTCCGTTTTCTACGCTTCTT TGGAGACTGCTCCCAGTTCTACCTACGGTC 2014-07-19 2014-07-19
snp_cf0006000592855 CRW C CCTGAGGTGTTTCCGTTTTCTACGCTTCTT TGGAGACTGCTCCCAGTTCTACCTACGGTC 2014-07-19 2014-07-19
snp_cf0016000509568 DQ8 Y CCTGAGGTGTTTCCGTTTTCTACGCTTCTT TGGAGACTGCTCCCAGTTCTACCTACGGTC 2014-07-19 2014-07-19
snp_cf0068000494646 TM9 C CCTGAGGTGTTTCCGTTTTCTACGCTTCTT TGGAGACTGCTCCCAGTTCTACCTACGGTC 2014-07-19 2014-07-19
snp_cf0029000337631 GS5 C CCTGAGGTGTTTCCGTTTTCTACGCTTCTT TGGAGACTGCTCCCAGTTCTACCTACGGTC 2014-07-19 2014-07-19
snp_cf0010000505126 DQ2 Y CCTGAGGTGTTTCCGTTTTCTACGCTTCTT TGGAGACTGCTCCCAGTTCTACCTACGGTC 2014-07-19 2014-07-19
snp_cf0047000477595 LJ2 C CCTGAGGTGTTTCCGTTTTCTACGCTTCTT TGGAGACTGCTCCCAGTTCTACCTACGGTC 2014-07-19 2014-07-19
snp_cf0062000516997 TM3 C CCTGAGGTGTTTCCGTTTTCTACGCTTCTT TGGAGACTGCTCCCAGTTCTACCTACGGTC 2014-07-19 2014-07-19
snp_cf0005000627237 CHW C CCTGAGGTGTTTCCGTTTTCTACGCTTCTT TGGAGACTGCTCCCAGTTCTACCTACGGTC 2014-07-19 2014-07-19
snp_cf0066000515940 TM7 C CCTGAGGTGTTTCCGTTTTCTACGCTTCTT TGGAGACTGCTCCCAGTTCTACCTACGGTC 2014-07-19 2014-07-19
snp_cf0048000482336 LJ3 C CCTGAGGTGTTTCCGTTTTCTACGCTTCTT TGGAGACTGCTCCCAGTTCTACCTACGGTC 2014-07-19 2014-07-19
snp_cf0067000503055 TM8 C CCTGAGGTGTTTCCGTTTTCTACGCTTCTT TGGAGACTGCTCCCAGTTCTACCTACGGTC 2014-07-19 2014-07-19
snp_cf0031000390300 GS7 C CCTGAGGTGTTTCCGTTTTCTACGCTTCTT TGGAGACTGCTCCCAGTTCTACCTACGGTC 2014-07-19 2014-07-19
snp_cf0058000642291 LUPWRUS00003 C CCTGAGGTGTTTCCGTTTTCTACGCTTCTT TGGAGACTGCTCCCAGTTCTACCTACGGTC 2014-07-19 2014-07-19
snp_cf0045000438884 LJ10 Y CCTGAGGTGTTTCCGTTTTCTACGCTTCTT TGGAGACTGCTCCCAGTTCTACCTACGGTC 2014-07-19 2014-07-19
snp_cf0022000471550 FAMICHN00002 C CCTGAGGTGTTTCCGTTTTCTACGCTTCTT TGGAGACTGCTCCCAGTTCTACCTACGGTC 2014-07-19 2014-07-19
snp_cf0020000500456 FAMBTIM00001 C CCTGAGGTGTTTCCGTTTTCTACGCTTCTT TGGAGACTGCTCCCAGTTCTACCTACGGTC 2014-07-19 2014-07-19
snp_cf0078000522349 YJ9 C CCTGAGGTGTTTCCGTTTTCTACGCTTCTT TGGAGACTGCTCCCAGTTCTACCTACGGTC 2014-07-19 2014-07-19
snp_cf0041000483089 KM6 C CCTGAGGTGTTTCCGTTTTCTACGCTTCTT TGGAGACTGCTCCCAGTTCTACCTACGGTC 2014-07-19 2014-07-19
snp_cf0023000476556 FAMICHN00003 C CCTGAGGTGTTTCCGTTTTCTACGCTTCTT TGGAGACTGCTCCCAGTTCTACCTACGGTC 2014-07-19 2014-07-19
snp_cf0075000528489 YJ6 C CCTGAGGTGTTTCCGTTTTCTACGCTTCTT TGGAGACTGCTCCCAGTTCTACCTACGGTC 2014-07-19 2014-07-19
snp_cf0036000396848 KM1 C CCTGAGGTGTTTCCGTTTTCTACGCTTCTT TGGAGACTGCTCCCAGTTCTACCTACGGTC 2014-07-19 2014-07-19
snp_cf0001000251031 solidGW1 C CCTGAGGTGTTTCCGTTTTCTACGCTTCTT TGGAGACTGCTCCCAGTTCTACCTACGGTC 2014-08-01 2014-08-01
snp_cf0074000516448 YJ5 C CCTGAGGTGTTTCCGTTTTCTACGCTTCTT TGGAGACTGCTCCCAGTTCTACCTACGGTC 2014-07-19 2014-07-19
snp_cf0014000499359 DQ6 C CCTGAGGTGTTTCCGTTTTCTACGCTTCTT TGGAGACTGCTCCCAGTTCTACCTACGGTC 2014-07-19 2014-07-19
snp_cf0027000386884 GS3 C CCTGAGGTGTTTCCGTTTTCTACGCTTCTT TGGAGACTGCTCCCAGTTCTACCTACGGTC 2014-07-19 2014-07-19
snp_cf0025000371884 GS1 C CCTGAGGTGTTTCCGTTTTCTACGCTTCTT TGGAGACTGCTCCCAGTTCTACCTACGGTC 2014-07-19 2014-07-19
snp_cf0060000521779 TM1 Y CCTGAGGTGTTTCCGTTTTCTACGCTTCTT TGGAGACTGCTCCCAGTTCTACCTACGGTC 2014-07-19 2014-07-19
snp_cf0021000482606 FAMICHN00001 Y CCTGAGGTGTTTCCGTTTTCTACGCTTCTT TGGAGACTGCTCCCAGTTCTACCTACGGTC 2014-07-19 2014-07-19
snp_cf0044000444796 KM9 C CCTGAGGTGTTTCCGTTTTCTACGCTTCTT TGGAGACTGCTCCCAGTTCTACCTACGGTC 2014-07-19 2014-07-19
snp_cf0013000501873 DQ5 C CCTGAGGTGTTTCCGTTTTCTACGCTTCTT TGGAGACTGCTCCCAGTTCTACCTACGGTC 2014-07-19 2014-07-19
snp_cf0043000412826 KM8 Y CCTGAGGTGTTTCCGTTTTCTACGCTTCTT TGGAGACTGCTCCCAGTTCTACCTACGGTC 2014-07-19 2014-07-19
snp_cf0063000507070 TM4 C CCTGAGGTGTTTCCGTTTTCTACGCTTCTT TGGAGACTGCTCCCAGTTCTACCTACGGTC 2014-07-19 2014-07-19
snp_cf0056000652348 LUPWRUS00001 C CCTGAGGTGTTTCCGTTTTCTACGCTTCTT TGGAGACTGCTCCCAGTTCTACCTACGGTC 2014-07-19 2014-07-19
snp_cf0061000515271 TM2 C CCTGAGGTGTTTCCGTTTTCTACGCTTCTT TGGAGACTGCTCCCAGTTCTACCTACGGTC 2014-07-19 2014-07-19
snp_cf0054000457011 LJ9 C CCTGAGGTGTTTCCGTTTTCTACGCTTCTT TGGAGACTGCTCCCAGTTCTACCTACGGTC 2014-07-19 2014-07-19
snp_cf0069000527889 YJ10 Y CCTGAGGTGTTTCCGTTTTCTACGCTTCTT TGGAGACTGCTCCCAGTTCTACCTACGGTC 2014-07-19 2014-07-19
snp_cf0073000514680 YJ4 C CCTGAGGTGTTTCCGTTTTCTACGCTTCTT TGGAGACTGCTCCCAGTTCTACCTACGGTC 2014-07-19 2014-07-19
snp_cf0070000535183 YJ1 C CCTGAGGTGTTTCCGTTTTCTACGCTTCTT TGGAGACTGCTCCCAGTTCTACCTACGGTC 2014-07-19 2014-07-19
snp_cf0004000421047 Basenji C CCTGAGGTGTTTCCGTTTTCTACGCTTCTT TGGAGACTGCTCCCAGTTCTACCTACGGTC 2014-07-19 2014-07-19
snp_cf0052000493180 LJ7 C CCTGAGGTGTTTCCGTTTTCTACGCTTCTT TGGAGACTGCTCCCAGTTCTACCTACGGTC 2014-07-19 2014-07-19
snp_cf0035000478183 KM10 C CCTGAGGTGTTTCCGTTTTCTACGCTTCTT TGGAGACTGCTCCCAGTTCTACCTACGGTC 2014-07-19 2014-07-19
snp_cf0011000511731 DQ3 Y CCTGAGGTGTTTCCGTTTTCTACGCTTCTT TGGAGACTGCTCCCAGTTCTACCTACGGTC 2014-07-19 2014-07-19
snp_cf0049000521042 LJ4 C CCTGAGGTGTTTCCGTTTTCTACGCTTCTT TGGAGACTGCTCCCAGTTCTACCTACGGTC 2014-07-19 2014-07-19
snp_cf0002000332929 CID1 C CCTGAGGTGTTTCCGTTTTCTACGCTTCTT TGGAGACTGCTCCCAGTTCTACCTACGGTC 2014-08-02 2014-08-02
snp_cf0042000497516 KM7 C CCTGAGGTGTTTCCGTTTTCTACGCTTCTT TGGAGACTGCTCCCAGTTCTACCTACGGTC 2014-07-19 2014-07-19
snp_cf0018000418891 FAMBBEM00001 C CCTGAGGTGTTTCCGTTTTCTACGCTTCTT TGGAGACTGCTCCCAGTTCTACCTACGGTC 2014-07-19 2014-07-19
snp_cf0038000404871 KM3 C CCTGAGGTGTTTCCGTTTTCTACGCTTCTT TGGAGACTGCTCCCAGTTCTACCTACGGTC 2014-07-19 2014-07-19
snp_cf0071000519746 YJ2 C CCTGAGGTGTTTCCGTTTTCTACGCTTCTT TGGAGACTGCTCCCAGTTCTACCTACGGTC 2014-07-19 2014-07-19
snp_cf0046000454773 LJ1 C CCTGAGGTGTTTCCGTTTTCTACGCTTCTT TGGAGACTGCTCCCAGTTCTACCTACGGTC 2014-07-19 2014-07-19
snp_cf0032000383169 GS8 C CCTGAGGTGTTTCCGTTTTCTACGCTTCTT TGGAGACTGCTCCCAGTTCTACCTACGGTC 2014-07-19 2014-07-19
snp_cf0051000506225 LJ6 C CCTGAGGTGTTTCCGTTTTCTACGCTTCTT TGGAGACTGCTCCCAGTTCTACCTACGGTC 2014-07-19 2014-07-19
snp_cf0040000440857 KM5 C CCTGAGGTGTTTCCGTTTTCTACGCTTCTT TGGAGACTGCTCCCAGTTCTACCTACGGTC 2014-07-19 2014-07-19
snp_cf0057000631341 LUPWRUS00002 C CCTGAGGTGTTTCCGTTTTCTACGCTTCTT TGGAGACTGCTCCCAGTTCTACCTACGGTC 2014-07-19 2014-07-19
snp_cf0009000506023 DQ1 C CCTGAGGTGTTTCCGTTTTCTACGCTTCTT TGGAGACTGCTCCCAGTTCTACCTACGGTC 2014-07-19 2014-07-19
snp_cf0076000524254 YJ7 C CCTGAGGTGTTTCCGTTTTCTACGCTTCTT TGGAGACTGCTCCCAGTTCTACCTACGGTC 2014-07-19 2014-07-19
snp_cf0055000647302 LUPWCHN00001 C CCTGAGGTGTTTCCGTTTTCTACGCTTCTT TGGAGACTGCTCCCAGTTCTACCTACGGTC 2014-07-19 2014-07-19
snp_cf0065000483009 TM6 C CCTGAGGTGTTTCCGTTTTCTACGCTTCTT TGGAGACTGCTCCCAGTTCTACCTACGGTC 2014-07-19 2014-07-19
snp_cf0015000506986 DQ7 C CCTGAGGTGTTTCCGTTTTCTACGCTTCTT TGGAGACTGCTCCCAGTTCTACCTACGGTC 2014-07-19 2014-07-19
snp_cf0039000402417 KM4 C CCTGAGGTGTTTCCGTTTTCTACGCTTCTT TGGAGACTGCTCCCAGTTCTACCTACGGTC 2014-07-19 2014-07-19
6.Fasta Information
TCCTCCTCCT GACATTTCTT CCTGAGGTGT TTCCGTTTTC TACGCTTCTT
C
TGGAGACTGC TCCCAGTTCT ACCTACGGTC TCCTCACTAC TCTCCTCACT