e.g. 1:1246..9423
SNP Detail For snp_cf0017000523405    [See in GBrowse]
1.General Information
SNP ID: snp_cf0017000523405
Organism: Canis familiaris
Individual: DQ9
Create time: 2014-07-19
Last update: 2014-07-19
2.Allele Information
Platform: SOLEXA
Method: sequence
SNP Class: snp
Genotype: C
5'flank: ATAAGACCGGGGCATGCTGGGTAGTACAGT
3'flank: CCTCCACAGCAGCTGATGATCTCTCCCATC
3.Reference Map information
Chrom Position Reference DQ9
Chr12 498375 G C
4.Gene information
Gene model(s)
Gene ID Position in Gene Strands Gene Allele Location
ENSCAFG00000000442 9065 - G CDS
Transcript Protein
SNP to transcript Accession Position in Transcript Allele change Accession Position in Protein Residue change
- ENSCAFT00000000700 5565 GGC => GGG ENSCAFP00000000644 1855 G => G
- ENSCAFT00000000703 3804 GGC => GGG ENSCAFP00000000647 1268 G => G
- ENSCAFT00000043014 3708 GGC => GGG ENSCAFP00000038554 1236 G => G
5.SNPs of other individuals in this position
SNP_ID Individual Genotype 5' Near Seq 30 bp 3' Near Seq 30 bp Create time Last update time
snp_cf0004000421110 Basenji S ATAAGACCGGGGCATGCTGGGTAGTACAGT CCTCCACAGCAGCTGATGATCTCTCCCATC 2014-07-19 2014-07-19
snp_cf0005000627285 CHW C ATAAGACCGGGGCATGCTGGGTAGTACAGT CCTCCACAGCAGCTGATGATCTCTCCCATC 2014-07-19 2014-07-19
snp_cf0075000528555 YJ6 S ATAAGACCGGGGCATGCTGGGTAGTACAGT CCTCCACAGCAGCTGATGATCTCTCCCATC 2014-07-19 2014-07-19
snp_cf0009000506091 DQ1 S ATAAGACCGGGGCATGCTGGGTAGTACAGT CCTCCACAGCAGCTGATGATCTCTCCCATC 2014-07-19 2014-07-19
snp_cf0008000502224 DQ10 C ATAAGACCGGGGCATGCTGGGTAGTACAGT CCTCCACAGCAGCTGATGATCTCTCCCATC 2014-07-19 2014-07-19
snp_cf0053000493201 LJ8 S ATAAGACCGGGGCATGCTGGGTAGTACAGT CCTCCACAGCAGCTGATGATCTCTCCCATC 2014-07-19 2014-07-19
snp_cf0010000505180 DQ2 S ATAAGACCGGGGCATGCTGGGTAGTACAGT CCTCCACAGCAGCTGATGATCTCTCCCATC 2014-07-19 2014-07-19
snp_cf0014000499401 DQ6 C ATAAGACCGGGGCATGCTGGGTAGTACAGT CCTCCACAGCAGCTGATGATCTCTCCCATC 2014-07-19 2014-07-19
snp_cf0046000454820 LJ1 S ATAAGACCGGGGCATGCTGGGTAGTACAGT CCTCCACAGCAGCTGATGATCTCTCCCATC 2014-07-19 2014-07-19
snp_cf0023000476604 FAMICHN00003 S ATAAGACCGGGGCATGCTGGGTAGTACAGT CCTCCACAGCAGCTGATGATCTCTCCCATC 2014-07-19 2014-07-19
snp_cf0072000524936 YJ3 S ATAAGACCGGGGCATGCTGGGTAGTACAGT CCTCCACAGCAGCTGATGATCTCTCCCATC 2014-07-19 2014-07-19
snp_cf0057000631405 LUPWRUS00002 C ATAAGACCGGGGCATGCTGGGTAGTACAGT CCTCCACAGCAGCTGATGATCTCTCCCATC 2014-07-19 2014-07-19
snp_cf0052000493234 LJ7 C ATAAGACCGGGGCATGCTGGGTAGTACAGT CCTCCACAGCAGCTGATGATCTCTCCCATC 2014-07-19 2014-07-19
snp_cf0006000592911 CRW S ATAAGACCGGGGCATGCTGGGTAGTACAGT CCTCCACAGCAGCTGATGATCTCTCCCATC 2014-07-19 2014-07-19
snp_cf0020000500506 FAMBTIM00001 S ATAAGACCGGGGCATGCTGGGTAGTACAGT CCTCCACAGCAGCTGATGATCTCTCCCATC 2014-07-19 2014-07-19
snp_cf0015000507046 DQ7 S ATAAGACCGGGGCATGCTGGGTAGTACAGT CCTCCACAGCAGCTGATGATCTCTCCCATC 2014-07-19 2014-07-19
snp_cf0067000503110 TM8 S ATAAGACCGGGGCATGCTGGGTAGTACAGT CCTCCACAGCAGCTGATGATCTCTCCCATC 2014-07-19 2014-07-19
snp_cf0013000501926 DQ5 S ATAAGACCGGGGCATGCTGGGTAGTACAGT CCTCCACAGCAGCTGATGATCTCTCCCATC 2014-07-19 2014-07-19
snp_cf0056000652397 LUPWRUS00001 S ATAAGACCGGGGCATGCTGGGTAGTACAGT CCTCCACAGCAGCTGATGATCTCTCCCATC 2014-07-19 2014-07-19
snp_cf0058000642364 LUPWRUS00003 S ATAAGACCGGGGCATGCTGGGTAGTACAGT CCTCCACAGCAGCTGATGATCTCTCCCATC 2014-07-19 2014-07-19
snp_cf0034000617540 ISW S ATAAGACCGGGGCATGCTGGGTAGTACAGT CCTCCACAGCAGCTGATGATCTCTCCCATC 2014-07-19 2014-07-19
6.Fasta Information
TGTGTTCCCA CCCATACCTT ATAAGACCGG GGCATGCTGG GTAGTACAGT
C
CCTCCACAGC AGCTGATGAT CTCTCCCATC TGAGGTGGTG GTGGCTGGAC