e.g. 1:1246..9423
SNP Detail For snp_cf0017000523413    [See in GBrowse]
1.General Information
SNP ID: snp_cf0017000523413
Organism: Canis familiaris
Individual: DQ9
Create time: 2014-07-19
Last update: 2014-07-19
2.Allele Information
Platform: SOLEXA
Method: sequence
SNP Class: snp
Genotype: T
5'flank: AACTGGTGCAGCCGATTCTGTCCCAGCATC
3'flank: CCTTCTGCTAGAAGCTGGTGCTTTCCAGTA
3.Reference Map information
Chrom Position Reference DQ9
Chr12 504694 C T
4.Gene information
Gene model(s)
Gene ID Position in Gene Strands Gene Allele Location
ENSCAFG00000000442 2746 - C CDS
ENSCAFG00000000442 2746 - C intron
Transcript Protein
SNP to transcript Accession Position in Transcript Allele change Accession Position in Protein Residue change
- ENSCAFT00000000700 1797 GGG => GGA ENSCAFP00000000644 599 G => G
- ENSCAFT00000043014 1710 GGG => GGA ENSCAFP00000038554 570 G => G
5.SNPs of other individuals in this position
SNP_ID Individual Genotype 5' Near Seq 30 bp 3' Near Seq 30 bp Create time Last update time
snp_cf0006000592921 CRW Y AACTGGTGCAGCCGATTCTGTCCCAGCATC CCTTCTGCTAGAAGCTGGTGCTTTCCAGTA 2014-07-19 2014-07-19
snp_cf0010000505190 DQ2 Y AACTGGTGCAGCCGATTCTGTCCCAGCATC CCTTCTGCTAGAAGCTGGTGCTTTCCAGTA 2014-07-19 2014-07-19
snp_cf0075000528562 YJ6 Y AACTGGTGCAGCCGATTCTGTCCCAGCATC CCTTCTGCTAGAAGCTGGTGCTTTCCAGTA 2014-07-19 2014-07-19
snp_cf0053000493211 LJ8 Y AACTGGTGCAGCCGATTCTGTCCCAGCATC CCTTCTGCTAGAAGCTGGTGCTTTCCAGTA 2014-07-19 2014-07-19
snp_cf0009000506098 DQ1 Y AACTGGTGCAGCCGATTCTGTCCCAGCATC CCTTCTGCTAGAAGCTGGTGCTTTCCAGTA 2014-07-19 2014-07-19
snp_cf0046000454831 LJ1 Y AACTGGTGCAGCCGATTCTGTCCCAGCATC CCTTCTGCTAGAAGCTGGTGCTTTCCAGTA 2014-07-19 2014-07-19
snp_cf0057000631413 LUPWRUS00002 T AACTGGTGCAGCCGATTCTGTCCCAGCATC CCTTCTGCTAGAAGCTGGTGCTTTCCAGTA 2014-07-19 2014-07-19
snp_cf0052000493242 LJ7 T AACTGGTGCAGCCGATTCTGTCCCAGCATC CCTTCTGCTAGAAGCTGGTGCTTTCCAGTA 2014-07-19 2014-07-19
snp_cf0023000476615 FAMICHN00003 Y AACTGGTGCAGCCGATTCTGTCCCAGCATC CCTTCTGCTAGAAGCTGGTGCTTTCCAGTA 2014-07-19 2014-07-19
snp_cf0008000502234 DQ10 Y AACTGGTGCAGCCGATTCTGTCCCAGCATC CCTTCTGCTAGAAGCTGGTGCTTTCCAGTA 2014-07-19 2014-07-19
snp_cf0072000524947 YJ3 Y AACTGGTGCAGCCGATTCTGTCCCAGCATC CCTTCTGCTAGAAGCTGGTGCTTTCCAGTA 2014-07-19 2014-07-19
snp_cf0067000503119 TM8 Y AACTGGTGCAGCCGATTCTGTCCCAGCATC CCTTCTGCTAGAAGCTGGTGCTTTCCAGTA 2014-07-19 2014-07-19
snp_cf0014000499408 DQ6 T AACTGGTGCAGCCGATTCTGTCCCAGCATC CCTTCTGCTAGAAGCTGGTGCTTTCCAGTA 2014-07-19 2014-07-19
snp_cf0020000500515 FAMBTIM00001 Y AACTGGTGCAGCCGATTCTGTCCCAGCATC CCTTCTGCTAGAAGCTGGTGCTTTCCAGTA 2014-07-19 2014-07-19
snp_cf0015000507056 DQ7 Y AACTGGTGCAGCCGATTCTGTCCCAGCATC CCTTCTGCTAGAAGCTGGTGCTTTCCAGTA 2014-07-19 2014-07-19
snp_cf0056000652405 LUPWRUS00001 Y AACTGGTGCAGCCGATTCTGTCCCAGCATC CCTTCTGCTAGAAGCTGGTGCTTTCCAGTA 2014-07-19 2014-07-19
snp_cf0013000501935 DQ5 Y AACTGGTGCAGCCGATTCTGTCCCAGCATC CCTTCTGCTAGAAGCTGGTGCTTTCCAGTA 2014-07-19 2014-07-19
snp_cf0034000617548 ISW Y AACTGGTGCAGCCGATTCTGTCCCAGCATC CCTTCTGCTAGAAGCTGGTGCTTTCCAGTA 2014-07-19 2014-07-19
snp_cf0058000642380 LUPWRUS00003 Y AACTGGTGCAGCCGATTCTGTCCCAGCATC CCTTCTGCTAGAAGCTGGTGCTTTCCAGTA 2014-07-19 2014-07-19
snp_cf0004000421119 Basenji Y AACTGGTGCAGCCGATTCTGTCCCAGCATC CCTTCTGCTAGAAGCTGGTGCTTTCCAGTA 2014-07-19 2014-07-19
snp_cf0005000627292 CHW T AACTGGTGCAGCCGATTCTGTCCCAGCATC CCTTCTGCTAGAAGCTGGTGCTTTCCAGTA 2014-07-19 2014-07-19
6.Fasta Information
AGAACTCTCT CCTGCTCAAG AACTGGTGCA GCCGATTCTG TCCCAGCATC
T
CCTTCTGCTA GAAGCTGGTG CTTTCCAGTA TCTGCCACCA GTGAGGCTGC