e.g. 1:1246..9423
SNP Detail For snp_cf0017000523415    [See in GBrowse]
1.General Information
SNP ID: snp_cf0017000523415
Organism: Canis familiaris
Individual: DQ9
Create time: 2014-07-19
Last update: 2014-07-19
NCBI rs link rs22193586  
2.Allele Information
Platform: SOLEXA
Method: sequence
SNP Class: snp
Genotype: G
5'flank: TACCCTGGGTGTCTCTTCTACAGTTAGAGG
3'flank: CCCCGGGAAACAAAGGGCAGGGGGACATTC
3.Reference Map information
Chrom Position Reference DQ9
Chr12 506460 A G
4.Gene information
Gene model(s)
Gene ID Position in Gene Strands Gene Allele Location
ENSCAFG00000000442 980 - A CDS
Transcript Protein
SNP to transcript Accession Position in Transcript Allele change Accession Position in Protein Residue change
- ENSCAFT00000000700 429 GGT => GGC ENSCAFP00000000644 143 G => G
- ENSCAFT00000043014 429 GGT => GGC ENSCAFP00000038554 143 G => G
5.SNPs of other individuals in this position
SNP_ID Individual Genotype 5' Near Seq 30 bp 3' Near Seq 30 bp Create time Last update time
snp_cf0061000515325 TM2 G TACCCTGGGTGTCTCTTCTACAGTTAGAGG CCCCGGGAAACAAAGGGCAGGGGGACATTC 2014-07-19 2014-07-19
snp_cf0008000502238 DQ10 G TACCCTGGGTGTCTCTTCTACAGTTAGAGG CCCCGGGAAACAAAGGGCAGGGGGACATTC 2014-07-19 2014-07-19
snp_cf0074000516506 YJ5 G TACCCTGGGTGTCTCTTCTACAGTTAGAGG CCCCGGGAAACAAAGGGCAGGGGGACATTC 2014-07-19 2014-07-19
snp_cf0028000383928 GS4 G TACCCTGGGTGTCTCTTCTACAGTTAGAGG CCCCGGGAAACAAAGGGCAGGGGGACATTC 2014-07-19 2014-07-19
snp_cf0014000499411 DQ6 G TACCCTGGGTGTCTCTTCTACAGTTAGAGG CCCCGGGAAACAAAGGGCAGGGGGACATTC 2014-07-19 2014-07-19
snp_cf0023000476619 FAMICHN00003 G TACCCTGGGTGTCTCTTCTACAGTTAGAGG CCCCGGGAAACAAAGGGCAGGGGGACATTC 2014-07-19 2014-07-19
snp_cf0066000515992 TM7 G TACCCTGGGTGTCTCTTCTACAGTTAGAGG CCCCGGGAAACAAAGGGCAGGGGGACATTC 2014-07-19 2014-07-19
snp_cf0015000507062 DQ7 G TACCCTGGGTGTCTCTTCTACAGTTAGAGG CCCCGGGAAACAAAGGGCAGGGGGACATTC 2014-07-19 2014-07-19
snp_cf0068000494677 TM9 G TACCCTGGGTGTCTCTTCTACAGTTAGAGG CCCCGGGAAACAAAGGGCAGGGGGACATTC 2014-07-19 2014-07-19
snp_cf0006000592925 CRW G TACCCTGGGTGTCTCTTCTACAGTTAGAGG CCCCGGGAAACAAAGGGCAGGGGGACATTC 2014-07-19 2014-07-19
snp_cf0041000483142 KM6 R TACCCTGGGTGTCTCTTCTACAGTTAGAGG CCCCGGGAAACAAAGGGCAGGGGGACATTC 2014-07-19 2014-07-19
snp_cf0022000471586 FAMICHN00002 G TACCCTGGGTGTCTCTTCTACAGTTAGAGG CCCCGGGAAACAAAGGGCAGGGGGACATTC 2014-07-19 2014-07-19
snp_cf0062000517045 TM3 G TACCCTGGGTGTCTCTTCTACAGTTAGAGG CCCCGGGAAACAAAGGGCAGGGGGACATTC 2014-07-19 2014-07-19
snp_cf0047000477653 LJ2 G TACCCTGGGTGTCTCTTCTACAGTTAGAGG CCCCGGGAAACAAAGGGCAGGGGGACATTC 2014-07-19 2014-07-19
snp_cf0054000457070 LJ9 G TACCCTGGGTGTCTCTTCTACAGTTAGAGG CCCCGGGAAACAAAGGGCAGGGGGACATTC 2014-07-19 2014-07-19
snp_cf0056000652409 LUPWRUS00001 G TACCCTGGGTGTCTCTTCTACAGTTAGAGG CCCCGGGAAACAAAGGGCAGGGGGACATTC 2014-07-19 2014-07-19
snp_cf0073000514742 YJ4 G TACCCTGGGTGTCTCTTCTACAGTTAGAGG CCCCGGGAAACAAAGGGCAGGGGGACATTC 2014-07-19 2014-07-19
snp_cf0064000515011 TM5 G TACCCTGGGTGTCTCTTCTACAGTTAGAGG CCCCGGGAAACAAAGGGCAGGGGGACATTC 2014-07-19 2014-07-19
snp_cf0053000493215 LJ8 G TACCCTGGGTGTCTCTTCTACAGTTAGAGG CCCCGGGAAACAAAGGGCAGGGGGACATTC 2014-07-19 2014-07-19
snp_cf0069000527941 YJ10 R TACCCTGGGTGTCTCTTCTACAGTTAGAGG CCCCGGGAAACAAAGGGCAGGGGGACATTC 2014-07-19 2014-07-19
snp_cf0024000419648 GS10 G TACCCTGGGTGTCTCTTCTACAGTTAGAGG CCCCGGGAAACAAAGGGCAGGGGGACATTC 2014-07-19 2014-07-19
snp_cf0046000454835 LJ1 G TACCCTGGGTGTCTCTTCTACAGTTAGAGG CCCCGGGAAACAAAGGGCAGGGGGACATTC 2014-07-19 2014-07-19
snp_cf0072000524952 YJ3 G TACCCTGGGTGTCTCTTCTACAGTTAGAGG CCCCGGGAAACAAAGGGCAGGGGGACATTC 2014-07-19 2014-07-19
snp_cf0029000337675 GS5 R TACCCTGGGTGTCTCTTCTACAGTTAGAGG CCCCGGGAAACAAAGGGCAGGGGGACATTC 2014-07-19 2014-07-19
snp_cf0011000511795 DQ3 G TACCCTGGGTGTCTCTTCTACAGTTAGAGG CCCCGGGAAACAAAGGGCAGGGGGACATTC 2014-07-19 2014-07-19
snp_cf0052000493244 LJ7 G TACCCTGGGTGTCTCTTCTACAGTTAGAGG CCCCGGGAAACAAAGGGCAGGGGGACATTC 2014-07-19 2014-07-19
snp_cf0030000395580 GS6 R TACCCTGGGTGTCTCTTCTACAGTTAGAGG CCCCGGGAAACAAAGGGCAGGGGGACATTC 2014-07-19 2014-07-19
snp_cf0034000617552 ISW G TACCCTGGGTGTCTCTTCTACAGTTAGAGG CCCCGGGAAACAAAGGGCAGGGGGACATTC 2014-07-19 2014-07-19
snp_cf0035000478239 KM10 R TACCCTGGGTGTCTCTTCTACAGTTAGAGG CCCCGGGAAACAAAGGGCAGGGGGACATTC 2014-07-19 2014-07-19
snp_cf0021000482670 FAMICHN00001 G TACCCTGGGTGTCTCTTCTACAGTTAGAGG CCCCGGGAAACAAAGGGCAGGGGGACATTC 2014-07-19 2014-07-19
snp_cf0059000516020 TM10 G TACCCTGGGTGTCTCTTCTACAGTTAGAGG CCCCGGGAAACAAAGGGCAGGGGGACATTC 2014-07-19 2014-07-19
snp_cf0044000444839 KM9 R TACCCTGGGTGTCTCTTCTACAGTTAGAGG CCCCGGGAAACAAAGGGCAGGGGGACATTC 2014-07-19 2014-07-19
snp_cf0075000528565 YJ6 G TACCCTGGGTGTCTCTTCTACAGTTAGAGG CCCCGGGAAACAAAGGGCAGGGGGACATTC 2014-07-19 2014-07-19
snp_cf0042000497585 KM7 G TACCCTGGGTGTCTCTTCTACAGTTAGAGG CCCCGGGAAACAAAGGGCAGGGGGACATTC 2014-07-19 2014-07-19
snp_cf0039000402452 KM4 G TACCCTGGGTGTCTCTTCTACAGTTAGAGG CCCCGGGAAACAAAGGGCAGGGGGACATTC 2014-07-19 2014-07-19
snp_cf0016000509635 DQ8 G TACCCTGGGTGTCTCTTCTACAGTTAGAGG CCCCGGGAAACAAAGGGCAGGGGGACATTC 2014-07-19 2014-07-19
snp_cf0007000424060 Dingo R TACCCTGGGTGTCTCTTCTACAGTTAGAGG CCCCGGGAAACAAAGGGCAGGGGGACATTC 2014-07-19 2014-07-19
snp_cf0010000505196 DQ2 G TACCCTGGGTGTCTCTTCTACAGTTAGAGG CCCCGGGAAACAAAGGGCAGGGGGACATTC 2014-07-19 2014-07-19
snp_cf0036000396883 KM1 G TACCCTGGGTGTCTCTTCTACAGTTAGAGG CCCCGGGAAACAAAGGGCAGGGGGACATTC 2014-07-19 2014-07-19
snp_cf0049000521079 LJ4 G TACCCTGGGTGTCTCTTCTACAGTTAGAGG CCCCGGGAAACAAAGGGCAGGGGGACATTC 2014-07-19 2014-07-19
snp_cf0003000276113 dbSNP139 G TACCCTGGGTGTCTCTTCTACAGTTAGAGG CCCCGGGAAACAAAGGGCAGGGGGACATTC 2014-07-19 2014-07-19
snp_cf0013000501940 DQ5 G TACCCTGGGTGTCTCTTCTACAGTTAGAGG CCCCGGGAAACAAAGGGCAGGGGGACATTC 2014-07-19 2014-07-19
snp_cf0078000522419 YJ9 G TACCCTGGGTGTCTCTTCTACAGTTAGAGG CCCCGGGAAACAAAGGGCAGGGGGACATTC 2014-07-19 2014-07-19
snp_cf0051000506257 LJ6 G TACCCTGGGTGTCTCTTCTACAGTTAGAGG CCCCGGGAAACAAAGGGCAGGGGGACATTC 2014-07-19 2014-07-19
snp_cf0067000503123 TM8 G TACCCTGGGTGTCTCTTCTACAGTTAGAGG CCCCGGGAAACAAAGGGCAGGGGGACATTC 2014-07-19 2014-07-19
snp_cf0050000457903 LJ5 G TACCCTGGGTGTCTCTTCTACAGTTAGAGG CCCCGGGAAACAAAGGGCAGGGGGACATTC 2014-07-19 2014-07-19
snp_cf0045000438930 LJ10 G TACCCTGGGTGTCTCTTCTACAGTTAGAGG CCCCGGGAAACAAAGGGCAGGGGGACATTC 2014-07-19 2014-07-19
snp_cf0055000647356 LUPWCHN00001 G TACCCTGGGTGTCTCTTCTACAGTTAGAGG CCCCGGGAAACAAAGGGCAGGGGGACATTC 2014-07-19 2014-07-19
snp_cf0043000412862 KM8 R TACCCTGGGTGTCTCTTCTACAGTTAGAGG CCCCGGGAAACAAAGGGCAGGGGGACATTC 2014-07-19 2014-07-19
snp_cf0070000535261 YJ1 G TACCCTGGGTGTCTCTTCTACAGTTAGAGG CCCCGGGAAACAAAGGGCAGGGGGACATTC 2014-07-19 2014-07-19
snp_cf0001000251081 solidGW1 G TACCCTGGGTGTCTCTTCTACAGTTAGAGG CCCCGGGAAACAAAGGGCAGGGGGACATTC 2014-08-01 2014-08-01
snp_cf0058000642386 LUPWRUS00003 G TACCCTGGGTGTCTCTTCTACAGTTAGAGG CCCCGGGAAACAAAGGGCAGGGGGACATTC 2014-07-19 2014-07-19
snp_cf0027000386953 GS3 G TACCCTGGGTGTCTCTTCTACAGTTAGAGG CCCCGGGAAACAAAGGGCAGGGGGACATTC 2014-07-19 2014-07-19
snp_cf0040000440891 KM5 G TACCCTGGGTGTCTCTTCTACAGTTAGAGG CCCCGGGAAACAAAGGGCAGGGGGACATTC 2014-07-19 2014-07-19
snp_cf0004000421123 Basenji G TACCCTGGGTGTCTCTTCTACAGTTAGAGG CCCCGGGAAACAAAGGGCAGGGGGACATTC 2014-07-19 2014-07-19
snp_cf0005000627294 CHW G TACCCTGGGTGTCTCTTCTACAGTTAGAGG CCCCGGGAAACAAAGGGCAGGGGGACATTC 2014-07-19 2014-07-19
snp_cf0018000418937 FAMBBEM00001 R TACCCTGGGTGTCTCTTCTACAGTTAGAGG CCCCGGGAAACAAAGGGCAGGGGGACATTC 2014-07-19 2014-07-19
snp_cf0076000524324 YJ7 G TACCCTGGGTGTCTCTTCTACAGTTAGAGG CCCCGGGAAACAAAGGGCAGGGGGACATTC 2014-07-19 2014-07-19
snp_cf0002000332964 CID1 R TACCCTGGGTGTCTCTTCTACAGTTAGAGG CCCCGGGAAACAAAGGGCAGGGGGACATTC 2014-08-02 2014-08-02
snp_cf0048000482395 LJ3 G TACCCTGGGTGTCTCTTCTACAGTTAGAGG CCCCGGGAAACAAAGGGCAGGGGGACATTC 2014-07-19 2014-07-19
snp_cf0025000371934 GS1 G TACCCTGGGTGTCTCTTCTACAGTTAGAGG CCCCGGGAAACAAAGGGCAGGGGGACATTC 2014-07-19 2014-07-19
snp_cf0057000631415 LUPWRUS00002 G TACCCTGGGTGTCTCTTCTACAGTTAGAGG CCCCGGGAAACAAAGGGCAGGGGGACATTC 2014-07-19 2014-07-19
snp_cf0031000390363 GS7 G TACCCTGGGTGTCTCTTCTACAGTTAGAGG CCCCGGGAAACAAAGGGCAGGGGGACATTC 2014-07-19 2014-07-19
snp_cf0019000386547 FAMBGSD00001 G TACCCTGGGTGTCTCTTCTACAGTTAGAGG CCCCGGGAAACAAAGGGCAGGGGGACATTC 2014-07-19 2014-07-19
snp_cf0060000521829 TM1 G TACCCTGGGTGTCTCTTCTACAGTTAGAGG CCCCGGGAAACAAAGGGCAGGGGGACATTC 2014-07-19 2014-07-19
snp_cf0032000383203 GS8 G TACCCTGGGTGTCTCTTCTACAGTTAGAGG CCCCGGGAAACAAAGGGCAGGGGGACATTC 2014-07-19 2014-07-19
snp_cf0065000483043 TM6 G TACCCTGGGTGTCTCTTCTACAGTTAGAGG CCCCGGGAAACAAAGGGCAGGGGGACATTC 2014-07-19 2014-07-19
snp_cf0009000506102 DQ1 G TACCCTGGGTGTCTCTTCTACAGTTAGAGG CCCCGGGAAACAAAGGGCAGGGGGACATTC 2014-07-19 2014-07-19
snp_cf0020000500519 FAMBTIM00001 G TACCCTGGGTGTCTCTTCTACAGTTAGAGG CCCCGGGAAACAAAGGGCAGGGGGACATTC 2014-07-19 2014-07-19
snp_cf0063000507126 TM4 G TACCCTGGGTGTCTCTTCTACAGTTAGAGG CCCCGGGAAACAAAGGGCAGGGGGACATTC 2014-07-19 2014-07-19
snp_cf0037000412238 KM2 G TACCCTGGGTGTCTCTTCTACAGTTAGAGG CCCCGGGAAACAAAGGGCAGGGGGACATTC 2014-07-19 2014-07-19
snp_cf0026000389946 GS2 G TACCCTGGGTGTCTCTTCTACAGTTAGAGG CCCCGGGAAACAAAGGGCAGGGGGACATTC 2014-07-19 2014-07-19
snp_cf0038000404909 KM3 R TACCCTGGGTGTCTCTTCTACAGTTAGAGG CCCCGGGAAACAAAGGGCAGGGGGACATTC 2014-07-19 2014-07-19
snp_cf0033000406297 GS9 G TACCCTGGGTGTCTCTTCTACAGTTAGAGG CCCCGGGAAACAAAGGGCAGGGGGACATTC 2014-07-19 2014-07-19
snp_cf0012000504460 DQ4 G TACCCTGGGTGTCTCTTCTACAGTTAGAGG CCCCGGGAAACAAAGGGCAGGGGGACATTC 2014-07-19 2014-07-19
6.Fasta Information
TGGGGTTGAG TTCCTCCCTG TACCCTGGGT GTCTCTTCTA CAGTTAGAGG
G
CCCCGGGAAA CAAAGGGCAG GGGGACATTC AGGCGATGGT ACTGGCAGGG