e.g. 1:1246..9423
SNP Detail For snp_cf0017001318570    [See in GBrowse]
1.General Information
SNP ID: snp_cf0017001318570
Organism: Canis familiaris
Individual: DQ9
Create time: 2014-07-19
Last update: 2014-07-19
2.Allele Information
Platform: SOLEXA
Method: sequence
SNP Class: snp
Genotype: A
5'flank: GCTGTGCCCCGTCTCTGCAGGATCCCCAAC
3'flank: TTTCCATGCCCGATTACATGGTTTACGAAG
3.Reference Map information
Chrom Position Reference DQ9
Chr18 89852 G A
4.Gene information
Gene model(s)
Gene ID Position in Gene Strands Gene Allele Location
ENSCAFG00000014131 7698 + G CDS
Transcript Protein
SNP to transcript Accession Position in Transcript Allele change Accession Position in Protein Residue change
+ ENSCAFT00000022427 364 GTT => ATT ENSCAFP00000020824 122 V => I
5.SNPs of other individuals in this position
SNP_ID Individual Genotype 5' Near Seq 30 bp 3' Near Seq 30 bp Create time Last update time
snp_cf0060001300130 TM1 R GCTGTGCCCCGTCTCTGCAGGATCCCCAAC TTTCCATGCCCGATTACATGGTTTACGAAG 2014-07-19 2014-07-19
snp_cf0011001329158 DQ3 A GCTGTGCCCCGTCTCTGCAGGATCCCCAAC TTTCCATGCCCGATTACATGGTTTACGAAG 2014-07-19 2014-07-19
snp_cf0029000943923 GS5 R GCTGTGCCCCGTCTCTGCAGGATCCCCAAC TTTCCATGCCCGATTACATGGTTTACGAAG 2014-07-19 2014-07-19
snp_cf0037001102161 KM2 R GCTGTGCCCCGTCTCTGCAGGATCCCCAAC TTTCCATGCCCGATTACATGGTTTACGAAG 2014-07-19 2014-07-19
snp_cf0072001343499 YJ3 R GCTGTGCCCCGTCTCTGCAGGATCCCCAAC TTTCCATGCCCGATTACATGGTTTACGAAG 2014-07-19 2014-07-19
snp_cf0041001311172 KM6 R GCTGTGCCCCGTCTCTGCAGGATCCCCAAC TTTCCATGCCCGATTACATGGTTTACGAAG 2014-07-19 2014-07-19
snp_cf0014001292907 DQ6 A GCTGTGCCCCGTCTCTGCAGGATCCCCAAC TTTCCATGCCCGATTACATGGTTTACGAAG 2014-07-19 2014-07-19
snp_cf0042001356770 KM7 R GCTGTGCCCCGTCTCTGCAGGATCCCCAAC TTTCCATGCCCGATTACATGGTTTACGAAG 2014-07-19 2014-07-19
snp_cf0030001026782 GS6 A GCTGTGCCCCGTCTCTGCAGGATCCCCAAC TTTCCATGCCCGATTACATGGTTTACGAAG 2014-07-19 2014-07-19
snp_cf0025001007492 GS1 R GCTGTGCCCCGTCTCTGCAGGATCCCCAAC TTTCCATGCCCGATTACATGGTTTACGAAG 2014-07-19 2014-07-19
snp_cf0059001306474 TM10 R GCTGTGCCCCGTCTCTGCAGGATCCCCAAC TTTCCATGCCCGATTACATGGTTTACGAAG 2014-07-19 2014-07-19
snp_cf0047001265485 LJ2 A GCTGTGCCCCGTCTCTGCAGGATCCCCAAC TTTCCATGCCCGATTACATGGTTTACGAAG 2014-07-19 2014-07-19
snp_cf0069001349675 YJ10 R GCTGTGCCCCGTCTCTGCAGGATCCCCAAC TTTCCATGCCCGATTACATGGTTTACGAAG 2014-07-19 2014-07-19
snp_cf0073001292865 YJ4 R GCTGTGCCCCGTCTCTGCAGGATCCCCAAC TTTCCATGCCCGATTACATGGTTTACGAAG 2014-07-19 2014-07-19
snp_cf0066001336139 TM7 R GCTGTGCCCCGTCTCTGCAGGATCCCCAAC TTTCCATGCCCGATTACATGGTTTACGAAG 2014-07-19 2014-07-19
snp_cf0043001090774 KM8 R GCTGTGCCCCGTCTCTGCAGGATCCCCAAC TTTCCATGCCCGATTACATGGTTTACGAAG 2014-07-19 2014-07-19
snp_cf0076001348978 YJ7 R GCTGTGCCCCGTCTCTGCAGGATCCCCAAC TTTCCATGCCCGATTACATGGTTTACGAAG 2014-07-19 2014-07-19
snp_cf0032001009674 GS8 R GCTGTGCCCCGTCTCTGCAGGATCCCCAAC TTTCCATGCCCGATTACATGGTTTACGAAG 2014-07-19 2014-07-19
snp_cf0077001325251 YJ8 R GCTGTGCCCCGTCTCTGCAGGATCCCCAAC TTTCCATGCCCGATTACATGGTTTACGAAG 2014-07-19 2014-07-19
snp_cf0013001252438 DQ5 A GCTGTGCCCCGTCTCTGCAGGATCCCCAAC TTTCCATGCCCGATTACATGGTTTACGAAG 2014-07-19 2014-07-19
snp_cf0050001214321 LJ5 A GCTGTGCCCCGTCTCTGCAGGATCCCCAAC TTTCCATGCCCGATTACATGGTTTACGAAG 2014-07-19 2014-07-19
snp_cf0067001279466 TM8 R GCTGTGCCCCGTCTCTGCAGGATCCCCAAC TTTCCATGCCCGATTACATGGTTTACGAAG 2014-07-19 2014-07-19
snp_cf0028000963691 GS4 A GCTGTGCCCCGTCTCTGCAGGATCCCCAAC TTTCCATGCCCGATTACATGGTTTACGAAG 2014-07-19 2014-07-19
snp_cf0012001303270 DQ4 A GCTGTGCCCCGTCTCTGCAGGATCCCCAAC TTTCCATGCCCGATTACATGGTTTACGAAG 2014-07-19 2014-07-19
snp_cf0052001274075 LJ7 R GCTGTGCCCCGTCTCTGCAGGATCCCCAAC TTTCCATGCCCGATTACATGGTTTACGAAG 2014-07-19 2014-07-19
snp_cf0064001317044 TM5 R GCTGTGCCCCGTCTCTGCAGGATCCCCAAC TTTCCATGCCCGATTACATGGTTTACGAAG 2014-07-19 2014-07-19
snp_cf0075001339815 YJ6 A GCTGTGCCCCGTCTCTGCAGGATCCCCAAC TTTCCATGCCCGATTACATGGTTTACGAAG 2014-07-19 2014-07-19
snp_cf0026001001739 GS2 R GCTGTGCCCCGTCTCTGCAGGATCCCCAAC TTTCCATGCCCGATTACATGGTTTACGAAG 2014-07-19 2014-07-19
snp_cf0024001052860 GS10 R GCTGTGCCCCGTCTCTGCAGGATCCCCAAC TTTCCATGCCCGATTACATGGTTTACGAAG 2014-07-19 2014-07-19
snp_cf0035001262746 KM10 R GCTGTGCCCCGTCTCTGCAGGATCCCCAAC TTTCCATGCCCGATTACATGGTTTACGAAG 2014-07-19 2014-07-19
snp_cf0078001336389 YJ9 A GCTGTGCCCCGTCTCTGCAGGATCCCCAAC TTTCCATGCCCGATTACATGGTTTACGAAG 2014-07-19 2014-07-19
snp_cf0051001306416 LJ6 R GCTGTGCCCCGTCTCTGCAGGATCCCCAAC TTTCCATGCCCGATTACATGGTTTACGAAG 2014-07-19 2014-07-19
snp_cf0054001168608 LJ9 R GCTGTGCCCCGTCTCTGCAGGATCCCCAAC TTTCCATGCCCGATTACATGGTTTACGAAG 2014-07-19 2014-07-19
snp_cf0033001016243 GS9 R GCTGTGCCCCGTCTCTGCAGGATCCCCAAC TTTCCATGCCCGATTACATGGTTTACGAAG 2014-07-19 2014-07-19
snp_cf0009001308250 DQ1 A GCTGTGCCCCGTCTCTGCAGGATCCCCAAC TTTCCATGCCCGATTACATGGTTTACGAAG 2014-07-19 2014-07-19
snp_cf0016001303921 DQ8 A GCTGTGCCCCGTCTCTGCAGGATCCCCAAC TTTCCATGCCCGATTACATGGTTTACGAAG 2014-07-19 2014-07-19
snp_cf0062001317972 TM3 A GCTGTGCCCCGTCTCTGCAGGATCCCCAAC TTTCCATGCCCGATTACATGGTTTACGAAG 2014-07-19 2014-07-19
snp_cf0063001287737 TM4 R GCTGTGCCCCGTCTCTGCAGGATCCCCAAC TTTCCATGCCCGATTACATGGTTTACGAAG 2014-07-19 2014-07-19
snp_cf0027001014750 GS3 R GCTGTGCCCCGTCTCTGCAGGATCCCCAAC TTTCCATGCCCGATTACATGGTTTACGAAG 2014-07-19 2014-07-19
snp_cf0038001003520 KM3 R GCTGTGCCCCGTCTCTGCAGGATCCCCAAC TTTCCATGCCCGATTACATGGTTTACGAAG 2014-07-19 2014-07-19
snp_cf0019001006668 FAMBGSD00001 R GCTGTGCCCCGTCTCTGCAGGATCCCCAAC TTTCCATGCCCGATTACATGGTTTACGAAG 2014-07-19 2014-07-19
snp_cf0039001054993 KM4 A GCTGTGCCCCGTCTCTGCAGGATCCCCAAC TTTCCATGCCCGATTACATGGTTTACGAAG 2014-07-19 2014-07-19
snp_cf0010001288795 DQ2 A GCTGTGCCCCGTCTCTGCAGGATCCCCAAC TTTCCATGCCCGATTACATGGTTTACGAAG 2014-07-19 2014-07-19
snp_cf0068001258048 TM9 A GCTGTGCCCCGTCTCTGCAGGATCCCCAAC TTTCCATGCCCGATTACATGGTTTACGAAG 2014-07-19 2014-07-19
snp_cf0040001165081 KM5 A GCTGTGCCCCGTCTCTGCAGGATCCCCAAC TTTCCATGCCCGATTACATGGTTTACGAAG 2014-07-19 2014-07-19
snp_cf0061001325552 TM2 R GCTGTGCCCCGTCTCTGCAGGATCCCCAAC TTTCCATGCCCGATTACATGGTTTACGAAG 2014-07-19 2014-07-19
snp_cf0070001383051 YJ1 R GCTGTGCCCCGTCTCTGCAGGATCCCCAAC TTTCCATGCCCGATTACATGGTTTACGAAG 2014-07-19 2014-07-19
snp_cf0031001014428 GS7 A GCTGTGCCCCGTCTCTGCAGGATCCCCAAC TTTCCATGCCCGATTACATGGTTTACGAAG 2014-07-19 2014-07-19
6.Fasta Information
GGGAGTGGCC TCAGGTGGGC GCTGTGCCCC GTCTCTGCAG GATCCCCAAC
A
TTTCCATGCC CGATTACATG GTTTACGAAG AGTTTCACCC CGAGCCGGCC