e.g. 1:1246..9423
SNP Detail For snp_cf0017001318606    [See in GBrowse]
1.General Information
SNP ID: snp_cf0017001318606
Organism: Canis familiaris
Individual: DQ9
Create time: 2014-07-19
Last update: 2014-07-19
2.Allele Information
Platform: SOLEXA
Method: sequence
SNP Class: snp
Genotype: T
5'flank: TTCTCAGTCCCCGAGTCCTCGAGGGTCACC
3'flank: CTGCCCGCCCCACGGTTTGCACGCTTTCCC
3.Reference Map information
Chrom Position Reference DQ9
Chr18 161612 C T
4.Gene information
Gene model(s)
Gene ID Position in Gene Strands Gene Allele Location
ENSCAFG00000003334 5747 + C CDS
Transcript Protein
SNP to transcript Accession Position in Transcript Allele change Accession Position in Protein Residue change
+ ENSCAFT00000005349 242 CCC => CTC ENSCAFP00000004953 81 P => L
5.SNPs of other individuals in this position
SNP_ID Individual Genotype 5' Near Seq 30 bp 3' Near Seq 30 bp Create time Last update time
snp_cf0078001336427 YJ9 Y TTCTCAGTCCCCGAGTCCTCGAGGGTCACC CTGCCCGCCCCACGGTTTGCACGCTTTCCC 2014-07-19 2014-07-19
snp_cf0040001165117 KM5 T TTCTCAGTCCCCGAGTCCTCGAGGGTCACC CTGCCCGCCCCACGGTTTGCACGCTTTCCC 2014-07-19 2014-07-19
snp_cf0063001287771 TM4 Y TTCTCAGTCCCCGAGTCCTCGAGGGTCACC CTGCCCGCCCCACGGTTTGCACGCTTTCCC 2014-07-19 2014-07-19
snp_cf0073001292899 YJ4 Y TTCTCAGTCCCCGAGTCCTCGAGGGTCACC CTGCCCGCCCCACGGTTTGCACGCTTTCCC 2014-07-19 2014-07-19
snp_cf0007001118130 Dingo T TTCTCAGTCCCCGAGTCCTCGAGGGTCACC CTGCCCGCCCCACGGTTTGCACGCTTTCCC 2014-07-19 2014-07-19
snp_cf0064001317081 TM5 Y TTCTCAGTCCCCGAGTCCTCGAGGGTCACC CTGCCCGCCCCACGGTTTGCACGCTTTCCC 2014-07-19 2014-07-19
snp_cf0075001339853 YJ6 Y TTCTCAGTCCCCGAGTCCTCGAGGGTCACC CTGCCCGCCCCACGGTTTGCACGCTTTCCC 2014-07-19 2014-07-19
snp_cf0038001003555 KM3 Y TTCTCAGTCCCCGAGTCCTCGAGGGTCACC CTGCCCGCCCCACGGTTTGCACGCTTTCCC 2014-07-19 2014-07-19
snp_cf0062001318008 TM3 T TTCTCAGTCCCCGAGTCCTCGAGGGTCACC CTGCCCGCCCCACGGTTTGCACGCTTTCCC 2014-07-19 2014-07-19
snp_cf0026001001776 GS2 Y TTCTCAGTCCCCGAGTCCTCGAGGGTCACC CTGCCCGCCCCACGGTTTGCACGCTTTCCC 2014-07-19 2014-07-19
snp_cf0056001650448 LUPWRUS00001 T TTCTCAGTCCCCGAGTCCTCGAGGGTCACC CTGCCCGCCCCACGGTTTGCACGCTTTCCC 2014-07-19 2014-07-19
snp_cf0027001014787 GS3 Y TTCTCAGTCCCCGAGTCCTCGAGGGTCACC CTGCCCGCCCCACGGTTTGCACGCTTTCCC 2014-07-19 2014-07-19
snp_cf0011001329194 DQ3 T TTCTCAGTCCCCGAGTCCTCGAGGGTCACC CTGCCCGCCCCACGGTTTGCACGCTTTCCC 2014-07-19 2014-07-19
snp_cf0061001325583 TM2 Y TTCTCAGTCCCCGAGTCCTCGAGGGTCACC CTGCCCGCCCCACGGTTTGCACGCTTTCCC 2014-07-19 2014-07-19
snp_cf0005001579928 CHW T TTCTCAGTCCCCGAGTCCTCGAGGGTCACC CTGCCCGCCCCACGGTTTGCACGCTTTCCC 2014-07-19 2014-07-19
snp_cf0025001007527 GS1 Y TTCTCAGTCCCCGAGTCCTCGAGGGTCACC CTGCCCGCCCCACGGTTTGCACGCTTTCCC 2014-07-19 2014-07-19
snp_cf0014001292944 DQ6 T TTCTCAGTCCCCGAGTCCTCGAGGGTCACC CTGCCCGCCCCACGGTTTGCACGCTTTCCC 2014-07-19 2014-07-19
snp_cf0052001274112 LJ7 Y TTCTCAGTCCCCGAGTCCTCGAGGGTCACC CTGCCCGCCCCACGGTTTGCACGCTTTCCC 2014-07-19 2014-07-19
snp_cf0032001009710 GS8 Y TTCTCAGTCCCCGAGTCCTCGAGGGTCACC CTGCCCGCCCCACGGTTTGCACGCTTTCCC 2014-07-19 2014-07-19
snp_cf0068001258084 TM9 Y TTCTCAGTCCCCGAGTCCTCGAGGGTCACC CTGCCCGCCCCACGGTTTGCACGCTTTCCC 2014-07-19 2014-07-19
snp_cf0070001383087 YJ1 Y TTCTCAGTCCCCGAGTCCTCGAGGGTCACC CTGCCCGCCCCACGGTTTGCACGCTTTCCC 2014-07-19 2014-07-19
snp_cf0066001336176 TM7 Y TTCTCAGTCCCCGAGTCCTCGAGGGTCACC CTGCCCGCCCCACGGTTTGCACGCTTTCCC 2014-07-19 2014-07-19
snp_cf0019001006702 FAMBGSD00001 Y TTCTCAGTCCCCGAGTCCTCGAGGGTCACC CTGCCCGCCCCACGGTTTGCACGCTTTCCC 2014-07-19 2014-07-19
snp_cf0059001306510 TM10 Y TTCTCAGTCCCCGAGTCCTCGAGGGTCACC CTGCCCGCCCCACGGTTTGCACGCTTTCCC 2014-07-19 2014-07-19
snp_cf0060001300162 TM1 Y TTCTCAGTCCCCGAGTCCTCGAGGGTCACC CTGCCCGCCCCACGGTTTGCACGCTTTCCC 2014-07-19 2014-07-19
snp_cf0024001052893 GS10 Y TTCTCAGTCCCCGAGTCCTCGAGGGTCACC CTGCCCGCCCCACGGTTTGCACGCTTTCCC 2014-07-19 2014-07-19
snp_cf0055001635480 LUPWCHN00001 T TTCTCAGTCCCCGAGTCCTCGAGGGTCACC CTGCCCGCCCCACGGTTTGCACGCTTTCCC 2014-07-19 2014-07-19
snp_cf0029000943957 GS5 Y TTCTCAGTCCCCGAGTCCTCGAGGGTCACC CTGCCCGCCCCACGGTTTGCACGCTTTCCC 2014-07-19 2014-07-19
snp_cf0010001288830 DQ2 T TTCTCAGTCCCCGAGTCCTCGAGGGTCACC CTGCCCGCCCCACGGTTTGCACGCTTTCCC 2014-07-19 2014-07-19
snp_cf0030001026819 GS6 Y TTCTCAGTCCCCGAGTCCTCGAGGGTCACC CTGCCCGCCCCACGGTTTGCACGCTTTCCC 2014-07-19 2014-07-19
snp_cf0042001356806 KM7 Y TTCTCAGTCCCCGAGTCCTCGAGGGTCACC CTGCCCGCCCCACGGTTTGCACGCTTTCCC 2014-07-19 2014-07-19
snp_cf0033001016279 GS9 Y TTCTCAGTCCCCGAGTCCTCGAGGGTCACC CTGCCCGCCCCACGGTTTGCACGCTTTCCC 2014-07-19 2014-07-19
snp_cf0016001303954 DQ8 T TTCTCAGTCCCCGAGTCCTCGAGGGTCACC CTGCCCGCCCCACGGTTTGCACGCTTTCCC 2014-07-19 2014-07-19
snp_cf0009001308285 DQ1 T TTCTCAGTCCCCGAGTCCTCGAGGGTCACC CTGCCCGCCCCACGGTTTGCACGCTTTCCC 2014-07-19 2014-07-19
snp_cf0051001306444 LJ6 Y TTCTCAGTCCCCGAGTCCTCGAGGGTCACC CTGCCCGCCCCACGGTTTGCACGCTTTCCC 2014-07-19 2014-07-19
snp_cf0012001303308 DQ4 T TTCTCAGTCCCCGAGTCCTCGAGGGTCACC CTGCCCGCCCCACGGTTTGCACGCTTTCCC 2014-07-19 2014-07-19
snp_cf0037001102198 KM2 Y TTCTCAGTCCCCGAGTCCTCGAGGGTCACC CTGCCCGCCCCACGGTTTGCACGCTTTCCC 2014-07-19 2014-07-19
snp_cf0028000963727 GS4 Y TTCTCAGTCCCCGAGTCCTCGAGGGTCACC CTGCCCGCCCCACGGTTTGCACGCTTTCCC 2014-07-19 2014-07-19
snp_cf0069001349709 YJ10 Y TTCTCAGTCCCCGAGTCCTCGAGGGTCACC CTGCCCGCCCCACGGTTTGCACGCTTTCCC 2014-07-19 2014-07-19
snp_cf0031001014465 GS7 T TTCTCAGTCCCCGAGTCCTCGAGGGTCACC CTGCCCGCCCCACGGTTTGCACGCTTTCCC 2014-07-19 2014-07-19
snp_cf0020001295626 FAMBTIM00001 Y TTCTCAGTCCCCGAGTCCTCGAGGGTCACC CTGCCCGCCCCACGGTTTGCACGCTTTCCC 2014-07-19 2014-07-19
snp_cf0006001514609 CRW T TTCTCAGTCCCCGAGTCCTCGAGGGTCACC CTGCCCGCCCCACGGTTTGCACGCTTTCCC 2014-07-19 2014-07-19
snp_cf0058001636946 LUPWRUS00003 Y TTCTCAGTCCCCGAGTCCTCGAGGGTCACC CTGCCCGCCCCACGGTTTGCACGCTTTCCC 2014-07-19 2014-07-19
snp_cf0013001252474 DQ5 T TTCTCAGTCCCCGAGTCCTCGAGGGTCACC CTGCCCGCCCCACGGTTTGCACGCTTTCCC 2014-07-19 2014-07-19
snp_cf0057001567364 LUPWRUS00002 Y TTCTCAGTCCCCGAGTCCTCGAGGGTCACC CTGCCCGCCCCACGGTTTGCACGCTTTCCC 2014-07-19 2014-07-19
snp_cf0067001279502 TM8 Y TTCTCAGTCCCCGAGTCCTCGAGGGTCACC CTGCCCGCCCCACGGTTTGCACGCTTTCCC 2014-07-19 2014-07-19
snp_cf0076001349012 YJ7 Y TTCTCAGTCCCCGAGTCCTCGAGGGTCACC CTGCCCGCCCCACGGTTTGCACGCTTTCCC 2014-07-19 2014-07-19
6.Fasta Information
GGCTTTGTCA CCTTTCTTCC TTCTCAGTCC CCGAGTCCTC GAGGGTCACC
T
CTGCCCGCCC CACGGTTTGC ACGCTTTCCC TAGTCGCCCC CATTCTGCCG