e.g. 1:1246..9423
SNP Detail For snp_cf0017001318624    [See in GBrowse]
1.General Information
SNP ID: snp_cf0017001318624
Organism: Canis familiaris
Individual: DQ9
Create time: 2014-07-19
Last update: 2014-07-19
NCBI rs link rs22664229  
2.Allele Information
Platform: SOLEXA
Method: sequence
SNP Class: snp
Genotype: G
5'flank: CGGCGGCCAGCGGCGGCGGCCCGGGCGGAC
3'flank: GGAGCAGCCGGGAGAGGAGTCCCTGCTTCG
3.Reference Map information
Chrom Position Reference DQ9
Chr18 170193 A G
4.Gene information
Gene model(s)
Gene ID Position in Gene Strands Gene Allele Location
ENSCAFG00000003334 14328 + A CDS
Transcript Protein
SNP to transcript Accession Position in Transcript Allele change Accession Position in Protein Residue change
+ ENSCAFT00000005349 1334 CAG => CGG ENSCAFP00000004953 445 Q => R
5.SNPs of other individuals in this position
SNP_ID Individual Genotype 5' Near Seq 30 bp 3' Near Seq 30 bp Create time Last update time
snp_cf0061001325604 TM2 R CGGCGGCCAGCGGCGGCGGCCCGGGCGGAC GGAGCAGCCGGGAGAGGAGTCCCTGCTTCG 2014-07-19 2014-07-19
snp_cf0012001303333 DQ4 G CGGCGGCCAGCGGCGGCGGCCCGGGCGGAC GGAGCAGCCGGGAGAGGAGTCCCTGCTTCG 2014-07-19 2014-07-19
snp_cf0052001274137 LJ7 R CGGCGGCCAGCGGCGGCGGCCCGGGCGGAC GGAGCAGCCGGGAGAGGAGTCCCTGCTTCG 2014-07-19 2014-07-19
snp_cf0070001383106 YJ1 R CGGCGGCCAGCGGCGGCGGCCCGGGCGGAC GGAGCAGCCGGGAGAGGAGTCCCTGCTTCG 2014-07-19 2014-07-19
snp_cf0033001016300 GS9 R CGGCGGCCAGCGGCGGCGGCCCGGGCGGAC GGAGCAGCCGGGAGAGGAGTCCCTGCTTCG 2014-07-19 2014-07-19
snp_cf0038001003579 KM3 R CGGCGGCCAGCGGCGGCGGCCCGGGCGGAC GGAGCAGCCGGGAGAGGAGTCCCTGCTTCG 2014-07-19 2014-07-19
snp_cf0037001102222 KM2 R CGGCGGCCAGCGGCGGCGGCCCGGGCGGAC GGAGCAGCCGGGAGAGGAGTCCCTGCTTCG 2014-07-19 2014-07-19
snp_cf0075001339879 YJ6 R CGGCGGCCAGCGGCGGCGGCCCGGGCGGAC GGAGCAGCCGGGAGAGGAGTCCCTGCTTCG 2014-07-19 2014-07-19
snp_cf0034001539254 ISW G CGGCGGCCAGCGGCGGCGGCCCGGGCGGAC GGAGCAGCCGGGAGAGGAGTCCCTGCTTCG 2014-07-19 2014-07-19
snp_cf0029000943980 GS5 G CGGCGGCCAGCGGCGGCGGCCCGGGCGGAC GGAGCAGCCGGGAGAGGAGTCCCTGCTTCG 2014-07-19 2014-07-19
snp_cf0030001026844 GS6 R CGGCGGCCAGCGGCGGCGGCCCGGGCGGAC GGAGCAGCCGGGAGAGGAGTCCCTGCTTCG 2014-07-19 2014-07-19
snp_cf0032001009733 GS8 R CGGCGGCCAGCGGCGGCGGCCCGGGCGGAC GGAGCAGCCGGGAGAGGAGTCCCTGCTTCG 2014-07-19 2014-07-19
snp_cf0062001318033 TM3 G CGGCGGCCAGCGGCGGCGGCCCGGGCGGAC GGAGCAGCCGGGAGAGGAGTCCCTGCTTCG 2014-07-19 2014-07-19
snp_cf0066001336199 TM7 R CGGCGGCCAGCGGCGGCGGCCCGGGCGGAC GGAGCAGCCGGGAGAGGAGTCCCTGCTTCG 2014-07-19 2014-07-19
snp_cf0014001292969 DQ6 G CGGCGGCCAGCGGCGGCGGCCCGGGCGGAC GGAGCAGCCGGGAGAGGAGTCCCTGCTTCG 2014-07-19 2014-07-19
snp_cf0025001007551 GS1 R CGGCGGCCAGCGGCGGCGGCCCGGGCGGAC GGAGCAGCCGGGAGAGGAGTCCCTGCTTCG 2014-07-19 2014-07-19
snp_cf0019001006724 FAMBGSD00001 G CGGCGGCCAGCGGCGGCGGCCCGGGCGGAC GGAGCAGCCGGGAGAGGAGTCCCTGCTTCG 2014-07-19 2014-07-19
snp_cf0072001343557 YJ3 G CGGCGGCCAGCGGCGGCGGCCCGGGCGGAC GGAGCAGCCGGGAGAGGAGTCCCTGCTTCG 2014-07-19 2014-07-19
snp_cf0009001308311 DQ1 G CGGCGGCCAGCGGCGGCGGCCCGGGCGGAC GGAGCAGCCGGGAGAGGAGTCCCTGCTTCG 2014-07-19 2014-07-19
snp_cf0078001336453 YJ9 R CGGCGGCCAGCGGCGGCGGCCCGGGCGGAC GGAGCAGCCGGGAGAGGAGTCCCTGCTTCG 2014-07-19 2014-07-19
snp_cf0069001349736 YJ10 R CGGCGGCCAGCGGCGGCGGCCCGGGCGGAC GGAGCAGCCGGGAGAGGAGTCCCTGCTTCG 2014-07-19 2014-07-19
snp_cf0003000735611 dbSNP139 G CGGCGGCCAGCGGCGGCGGCCCGGGCGGAC GGAGCAGCCGGGAGAGGAGTCCCTGCTTCG 2014-07-19 2014-07-19
snp_cf0041001311216 KM6 R CGGCGGCCAGCGGCGGCGGCCCGGGCGGAC GGAGCAGCCGGGAGAGGAGTCCCTGCTTCG 2014-07-19 2014-07-19
snp_cf0001000557640 solidGW1 G CGGCGGCCAGCGGCGGCGGCCCGGGCGGAC GGAGCAGCCGGGAGAGGAGTCCCTGCTTCG 2014-08-01 2014-08-01
snp_cf0011001329221 DQ3 G CGGCGGCCAGCGGCGGCGGCCCGGGCGGAC GGAGCAGCCGGGAGAGGAGTCCCTGCTTCG 2014-07-19 2014-07-19
snp_cf0040001165144 KM5 G CGGCGGCCAGCGGCGGCGGCCCGGGCGGAC GGAGCAGCCGGGAGAGGAGTCCCTGCTTCG 2014-07-19 2014-07-19
snp_cf0010001288856 DQ2 G CGGCGGCCAGCGGCGGCGGCCCGGGCGGAC GGAGCAGCCGGGAGAGGAGTCCCTGCTTCG 2014-07-19 2014-07-19
snp_cf0064001317099 TM5 R CGGCGGCCAGCGGCGGCGGCCCGGGCGGAC GGAGCAGCCGGGAGAGGAGTCCCTGCTTCG 2014-07-19 2014-07-19
snp_cf0073001292920 YJ4 R CGGCGGCCAGCGGCGGCGGCCCGGGCGGAC GGAGCAGCCGGGAGAGGAGTCCCTGCTTCG 2014-07-19 2014-07-19
snp_cf0059001306534 TM10 R CGGCGGCCAGCGGCGGCGGCCCGGGCGGAC GGAGCAGCCGGGAGAGGAGTCCCTGCTTCG 2014-07-19 2014-07-19
snp_cf0026001001800 GS2 R CGGCGGCCAGCGGCGGCGGCCCGGGCGGAC GGAGCAGCCGGGAGAGGAGTCCCTGCTTCG 2014-07-19 2014-07-19
snp_cf0031001014491 GS7 G CGGCGGCCAGCGGCGGCGGCCCGGGCGGAC GGAGCAGCCGGGAGAGGAGTCCCTGCTTCG 2014-07-19 2014-07-19
snp_cf0042001356829 KM7 R CGGCGGCCAGCGGCGGCGGCCCGGGCGGAC GGAGCAGCCGGGAGAGGAGTCCCTGCTTCG 2014-07-19 2014-07-19
snp_cf0027001014812 GS3 R CGGCGGCCAGCGGCGGCGGCCCGGGCGGAC GGAGCAGCCGGGAGAGGAGTCCCTGCTTCG 2014-07-19 2014-07-19
snp_cf0060001300189 TM1 R CGGCGGCCAGCGGCGGCGGCCCGGGCGGAC GGAGCAGCCGGGAGAGGAGTCCCTGCTTCG 2014-07-19 2014-07-19
snp_cf0016001303979 DQ8 G CGGCGGCCAGCGGCGGCGGCCCGGGCGGAC GGAGCAGCCGGGAGAGGAGTCCCTGCTTCG 2014-07-19 2014-07-19
snp_cf0007001118148 Dingo R CGGCGGCCAGCGGCGGCGGCCCGGGCGGAC GGAGCAGCCGGGAGAGGAGTCCCTGCTTCG 2014-07-19 2014-07-19
snp_cf0068001258110 TM9 G CGGCGGCCAGCGGCGGCGGCCCGGGCGGAC GGAGCAGCCGGGAGAGGAGTCCCTGCTTCG 2014-07-19 2014-07-19
snp_cf0024001052918 GS10 R CGGCGGCCAGCGGCGGCGGCCCGGGCGGAC GGAGCAGCCGGGAGAGGAGTCCCTGCTTCG 2014-07-19 2014-07-19
snp_cf0005001579961 CHW G CGGCGGCCAGCGGCGGCGGCCCGGGCGGAC GGAGCAGCCGGGAGAGGAGTCCCTGCTTCG 2014-07-19 2014-07-19
snp_cf0028000963751 GS4 R CGGCGGCCAGCGGCGGCGGCCCGGGCGGAC GGAGCAGCCGGGAGAGGAGTCCCTGCTTCG 2014-07-19 2014-07-19
snp_cf0013001252498 DQ5 G CGGCGGCCAGCGGCGGCGGCCCGGGCGGAC GGAGCAGCCGGGAGAGGAGTCCCTGCTTCG 2014-07-19 2014-07-19
snp_cf0057001567385 LUPWRUS00002 G CGGCGGCCAGCGGCGGCGGCCCGGGCGGAC GGAGCAGCCGGGAGAGGAGTCCCTGCTTCG 2014-07-19 2014-07-19
snp_cf0076001349032 YJ7 R CGGCGGCCAGCGGCGGCGGCCCGGGCGGAC GGAGCAGCCGGGAGAGGAGTCCCTGCTTCG 2014-07-19 2014-07-19
snp_cf0067001279524 TM8 R CGGCGGCCAGCGGCGGCGGCCCGGGCGGAC GGAGCAGCCGGGAGAGGAGTCCCTGCTTCG 2014-07-19 2014-07-19
snp_cf0058001636969 LUPWRUS00003 R CGGCGGCCAGCGGCGGCGGCCCGGGCGGAC GGAGCAGCCGGGAGAGGAGTCCCTGCTTCG 2014-07-19 2014-07-19
snp_cf0056001650481 LUPWRUS00001 G CGGCGGCCAGCGGCGGCGGCCCGGGCGGAC GGAGCAGCCGGGAGAGGAGTCCCTGCTTCG 2014-07-19 2014-07-19
6.Fasta Information
AGCCCTCGCG TGCCTGGAGG CGGCGGCCAG CGGCGGCGGC CCGGGCGGAC
G
GGAGCAGCCG GGAGAGGAGT CCCTGCTTCG GGAGCAGGAG CAGGTAAAGC