e.g. 1:1246..9423
SNP Detail For snp_cf0017001318648    [See in GBrowse]
1.General Information
SNP ID: snp_cf0017001318648
Organism: Canis familiaris
Individual: DQ9
Create time: 2014-07-19
Last update: 2014-07-19
NCBI rs link rs8883668  
2.Allele Information
Platform: SOLEXA
Method: sequence
SNP Class: snp
Genotype: S
5'flank: TCACTTAGCCCTGGCCAAGTAGGGAAATCC
3'flank: TTTTCACCATGGAAACTGCCCTGCATCAGC
3.Reference Map information
Chrom Position Reference DQ9
Chr18 179601 G S
4.Gene information
Gene model(s)
Gene ID Position in Gene Strands Gene Allele Location
ENSCAFG00000003334 23736 + G CDS
Transcript Protein
SNP to transcript Accession Position in Transcript Allele change Accession Position in Protein Residue change
+ ENSCAFT00000005349 3637 GTT => CTT ENSCAFP00000004953 1213 V => L
+ ENSCAFT00000044856 2071 GTT => CTT ENSCAFP00000038766 691 V => L
5.SNPs of other individuals in this position
SNP_ID Individual Genotype 5' Near Seq 30 bp 3' Near Seq 30 bp Create time Last update time
snp_cf0034001539271 ISW S TCACTTAGCCCTGGCCAAGTAGGGAAATCC TTTTCACCATGGAAACTGCCCTGCATCAGC 2014-07-19 2014-07-19
snp_cf0060001300213 TM1 S TCACTTAGCCCTGGCCAAGTAGGGAAATCC TTTTCACCATGGAAACTGCCCTGCATCAGC 2014-07-19 2014-07-19
snp_cf0057001567409 LUPWRUS00002 S TCACTTAGCCCTGGCCAAGTAGGGAAATCC TTTTCACCATGGAAACTGCCCTGCATCAGC 2014-07-19 2014-07-19
snp_cf0051001306483 LJ6 S TCACTTAGCCCTGGCCAAGTAGGGAAATCC TTTTCACCATGGAAACTGCCCTGCATCAGC 2014-07-19 2014-07-19
snp_cf0016001304003 DQ8 C TCACTTAGCCCTGGCCAAGTAGGGAAATCC TTTTCACCATGGAAACTGCCCTGCATCAGC 2014-07-19 2014-07-19
snp_cf0005001579991 CHW C TCACTTAGCCCTGGCCAAGTAGGGAAATCC TTTTCACCATGGAAACTGCCCTGCATCAGC 2014-07-19 2014-07-19
snp_cf0030001026869 GS6 S TCACTTAGCCCTGGCCAAGTAGGGAAATCC TTTTCACCATGGAAACTGCCCTGCATCAGC 2014-07-19 2014-07-19
snp_cf0025001007574 GS1 S TCACTTAGCCCTGGCCAAGTAGGGAAATCC TTTTCACCATGGAAACTGCCCTGCATCAGC 2014-07-19 2014-07-19
snp_cf0032001009756 GS8 S TCACTTAGCCCTGGCCAAGTAGGGAAATCC TTTTCACCATGGAAACTGCCCTGCATCAGC 2014-07-19 2014-07-19
snp_cf0050001214357 LJ5 S TCACTTAGCCCTGGCCAAGTAGGGAAATCC TTTTCACCATGGAAACTGCCCTGCATCAGC 2014-07-19 2014-07-19
snp_cf0069001349759 YJ10 S TCACTTAGCCCTGGCCAAGTAGGGAAATCC TTTTCACCATGGAAACTGCCCTGCATCAGC 2014-07-19 2014-07-19
snp_cf0075001339902 YJ6 S TCACTTAGCCCTGGCCAAGTAGGGAAATCC TTTTCACCATGGAAACTGCCCTGCATCAGC 2014-07-19 2014-07-19
snp_cf0059001306558 TM10 S TCACTTAGCCCTGGCCAAGTAGGGAAATCC TTTTCACCATGGAAACTGCCCTGCATCAGC 2014-07-19 2014-07-19
snp_cf0073001292943 YJ4 S TCACTTAGCCCTGGCCAAGTAGGGAAATCC TTTTCACCATGGAAACTGCCCTGCATCAGC 2014-07-19 2014-07-19
snp_cf0011001329245 DQ3 C TCACTTAGCCCTGGCCAAGTAGGGAAATCC TTTTCACCATGGAAACTGCCCTGCATCAGC 2014-07-19 2014-07-19
snp_cf0026001001823 GS2 S TCACTTAGCCCTGGCCAAGTAGGGAAATCC TTTTCACCATGGAAACTGCCCTGCATCAGC 2014-07-19 2014-07-19
snp_cf0019001006747 FAMBGSD00001 S TCACTTAGCCCTGGCCAAGTAGGGAAATCC TTTTCACCATGGAAACTGCCCTGCATCAGC 2014-07-19 2014-07-19
snp_cf0056001650514 LUPWRUS00001 C TCACTTAGCCCTGGCCAAGTAGGGAAATCC TTTTCACCATGGAAACTGCCCTGCATCAGC 2014-07-19 2014-07-19
snp_cf0038001003601 KM3 S TCACTTAGCCCTGGCCAAGTAGGGAAATCC TTTTCACCATGGAAACTGCCCTGCATCAGC 2014-07-19 2014-07-19
snp_cf0029000944004 GS5 S TCACTTAGCCCTGGCCAAGTAGGGAAATCC TTTTCACCATGGAAACTGCCCTGCATCAGC 2014-07-19 2014-07-19
snp_cf0062001318059 TM3 C TCACTTAGCCCTGGCCAAGTAGGGAAATCC TTTTCACCATGGAAACTGCCCTGCATCAGC 2014-07-19 2014-07-19
snp_cf0028000963776 GS4 S TCACTTAGCCCTGGCCAAGTAGGGAAATCC TTTTCACCATGGAAACTGCCCTGCATCAGC 2014-07-19 2014-07-19
snp_cf0037001102245 KM2 S TCACTTAGCCCTGGCCAAGTAGGGAAATCC TTTTCACCATGGAAACTGCCCTGCATCAGC 2014-07-19 2014-07-19
snp_cf0042001356849 KM7 S TCACTTAGCCCTGGCCAAGTAGGGAAATCC TTTTCACCATGGAAACTGCCCTGCATCAGC 2014-07-19 2014-07-19
snp_cf0055001635537 LUPWCHN00001 S TCACTTAGCCCTGGCCAAGTAGGGAAATCC TTTTCACCATGGAAACTGCCCTGCATCAGC 2014-07-19 2014-07-19
snp_cf0072001343580 YJ3 S TCACTTAGCCCTGGCCAAGTAGGGAAATCC TTTTCACCATGGAAACTGCCCTGCATCAGC 2014-07-19 2014-07-19
snp_cf0067001279546 TM8 S TCACTTAGCCCTGGCCAAGTAGGGAAATCC TTTTCACCATGGAAACTGCCCTGCATCAGC 2014-07-19 2014-07-19
snp_cf0061001325628 TM2 S TCACTTAGCCCTGGCCAAGTAGGGAAATCC TTTTCACCATGGAAACTGCCCTGCATCAGC 2014-07-19 2014-07-19
snp_cf0064001317122 TM5 S TCACTTAGCCCTGGCCAAGTAGGGAAATCC TTTTCACCATGGAAACTGCCCTGCATCAGC 2014-07-19 2014-07-19
snp_cf0012001303357 DQ4 C TCACTTAGCCCTGGCCAAGTAGGGAAATCC TTTTCACCATGGAAACTGCCCTGCATCAGC 2014-07-19 2014-07-19
snp_cf0047001265533 LJ2 S TCACTTAGCCCTGGCCAAGTAGGGAAATCC TTTTCACCATGGAAACTGCCCTGCATCAGC 2014-07-19 2014-07-19
snp_cf0024001052941 GS10 S TCACTTAGCCCTGGCCAAGTAGGGAAATCC TTTTCACCATGGAAACTGCCCTGCATCAGC 2014-07-19 2014-07-19
snp_cf0020001295674 FAMBTIM00001 S TCACTTAGCCCTGGCCAAGTAGGGAAATCC TTTTCACCATGGAAACTGCCCTGCATCAGC 2014-07-19 2014-07-19
snp_cf0010001288880 DQ2 C TCACTTAGCCCTGGCCAAGTAGGGAAATCC TTTTCACCATGGAAACTGCCCTGCATCAGC 2014-07-19 2014-07-19
snp_cf0033001016324 GS9 S TCACTTAGCCCTGGCCAAGTAGGGAAATCC TTTTCACCATGGAAACTGCCCTGCATCAGC 2014-07-19 2014-07-19
snp_cf0066001336222 TM7 S TCACTTAGCCCTGGCCAAGTAGGGAAATCC TTTTCACCATGGAAACTGCCCTGCATCAGC 2014-07-19 2014-07-19
snp_cf0063001287810 TM4 S TCACTTAGCCCTGGCCAAGTAGGGAAATCC TTTTCACCATGGAAACTGCCCTGCATCAGC 2014-07-19 2014-07-19
snp_cf0054001168641 LJ9 S TCACTTAGCCCTGGCCAAGTAGGGAAATCC TTTTCACCATGGAAACTGCCCTGCATCAGC 2014-07-19 2014-07-19
snp_cf0009001308336 DQ1 C TCACTTAGCCCTGGCCAAGTAGGGAAATCC TTTTCACCATGGAAACTGCCCTGCATCAGC 2014-07-19 2014-07-19
snp_cf0013001252522 DQ5 C TCACTTAGCCCTGGCCAAGTAGGGAAATCC TTTTCACCATGGAAACTGCCCTGCATCAGC 2014-07-19 2014-07-19
snp_cf0031001014515 GS7 C TCACTTAGCCCTGGCCAAGTAGGGAAATCC TTTTCACCATGGAAACTGCCCTGCATCAGC 2014-07-19 2014-07-19
snp_cf0058001636993 LUPWRUS00003 S TCACTTAGCCCTGGCCAAGTAGGGAAATCC TTTTCACCATGGAAACTGCCCTGCATCAGC 2014-07-19 2014-07-19
snp_cf0052001274163 LJ7 S TCACTTAGCCCTGGCCAAGTAGGGAAATCC TTTTCACCATGGAAACTGCCCTGCATCAGC 2014-07-19 2014-07-19
snp_cf0003000735616 dbSNP139 C TCACTTAGCCCTGGCCAAGTAGGGAAATCC TTTTCACCATGGAAACTGCCCTGCATCAGC 2014-07-19 2014-07-19
snp_cf0078001336476 YJ9 S TCACTTAGCCCTGGCCAAGTAGGGAAATCC TTTTCACCATGGAAACTGCCCTGCATCAGC 2014-07-19 2014-07-19
snp_cf0040001165169 KM5 C TCACTTAGCCCTGGCCAAGTAGGGAAATCC TTTTCACCATGGAAACTGCCCTGCATCAGC 2014-07-19 2014-07-19
snp_cf0006001514653 CRW C TCACTTAGCCCTGGCCAAGTAGGGAAATCC TTTTCACCATGGAAACTGCCCTGCATCAGC 2014-07-19 2014-07-19
snp_cf0014001292993 DQ6 C TCACTTAGCCCTGGCCAAGTAGGGAAATCC TTTTCACCATGGAAACTGCCCTGCATCAGC 2014-07-19 2014-07-19
snp_cf0007001118169 Dingo S TCACTTAGCCCTGGCCAAGTAGGGAAATCC TTTTCACCATGGAAACTGCCCTGCATCAGC 2014-07-19 2014-07-19
snp_cf0027001014835 GS3 S TCACTTAGCCCTGGCCAAGTAGGGAAATCC TTTTCACCATGGAAACTGCCCTGCATCAGC 2014-07-19 2014-07-19
snp_cf0070001383131 YJ1 S TCACTTAGCCCTGGCCAAGTAGGGAAATCC TTTTCACCATGGAAACTGCCCTGCATCAGC 2014-07-19 2014-07-19
snp_cf0068001258134 TM9 C TCACTTAGCCCTGGCCAAGTAGGGAAATCC TTTTCACCATGGAAACTGCCCTGCATCAGC 2014-07-19 2014-07-19
snp_cf0076001349056 YJ7 S TCACTTAGCCCTGGCCAAGTAGGGAAATCC TTTTCACCATGGAAACTGCCCTGCATCAGC 2014-07-19 2014-07-19
6.Fasta Information
ATGCATTAGT TTGGGTAAAG TCACTTAGCC CTGGCCAAGT AGGGAAATCC
S
TTTTCACCAT GGAAACTGCC CTGCATCAGC TAAAGACATT TCCATTAAAC