e.g. 1:1246..9423
SNP Detail For snp_cf0017001726668    [See in GBrowse]
1.General Information
SNP ID: snp_cf0017001726668
Organism: Canis familiaris
Individual: DQ9
Create time: 2014-07-19
Last update: 2014-07-19
2.Allele Information
Platform: SOLEXA
Method: sequence
SNP Class: snp
Genotype: R
5'flank: AGATGATCAGATCTATACCAAGACTGATAA
3'flank: TCATGTTGATAGTATCGATCCTTTATATGA
3.Reference Map information
Chrom Position Reference DQ9
Chr20 3473 A R
4.Gene information
Gene model(s)
Gene ID Position in Gene Strands Gene Allele Location
NA NA NA NA NA
Transcript Protein
SNP to transcript Accession Position in Transcript Allele change Accession Position in Protein Residue change
NA NA NA NA NA NA NA
5.SNPs of other individuals in this position
SNP_ID Individual Genotype 5' Near Seq 30 bp 3' Near Seq 30 bp Create time Last update time
snp_cf0059001700563 TM10 R AGATGATCAGATCTATACCAAGACTGATAA TCATGTTGATAGTATCGATCCTTTATATGA 2014-07-19 2014-07-19
snp_cf0061001733000 TM2 R AGATGATCAGATCTATACCAAGACTGATAA TCATGTTGATAGTATCGATCCTTTATATGA 2014-07-19 2014-07-19
snp_cf0014001678296 DQ6 R AGATGATCAGATCTATACCAAGACTGATAA TCATGTTGATAGTATCGATCCTTTATATGA 2014-07-19 2014-07-19
snp_cf0064001718185 TM5 R AGATGATCAGATCTATACCAAGACTGATAA TCATGTTGATAGTATCGATCCTTTATATGA 2014-07-19 2014-07-19
snp_cf0049001721916 LJ4 G AGATGATCAGATCTATACCAAGACTGATAA TCATGTTGATAGTATCGATCCTTTATATGA 2014-07-19 2014-07-19
snp_cf0045001537206 LJ10 R AGATGATCAGATCTATACCAAGACTGATAA TCATGTTGATAGTATCGATCCTTTATATGA 2014-07-19 2014-07-19
snp_cf0046001581134 LJ1 R AGATGATCAGATCTATACCAAGACTGATAA TCATGTTGATAGTATCGATCCTTTATATGA 2014-07-19 2014-07-19
snp_cf0062001712587 TM3 R AGATGATCAGATCTATACCAAGACTGATAA TCATGTTGATAGTATCGATCCTTTATATGA 2014-07-19 2014-07-19
snp_cf0047001654299 LJ2 R AGATGATCAGATCTATACCAAGACTGATAA TCATGTTGATAGTATCGATCCTTTATATGA 2014-07-19 2014-07-19
snp_cf0068001665334 TM9 R AGATGATCAGATCTATACCAAGACTGATAA TCATGTTGATAGTATCGATCCTTTATATGA 2014-07-19 2014-07-19
snp_cf0065001689459 TM6 R AGATGATCAGATCTATACCAAGACTGATAA TCATGTTGATAGTATCGATCCTTTATATGA 2014-07-19 2014-07-19
6.Fasta Information
CTGACAACAC TACCTCAGCA AGATGATCAG ATCTATACCA AGACTGATAA
R
TCATGTTGAT AGTATCGATC CTTTATATGA TATAATAAAA ATGGCAGTAT