e.g. 1:1246..9423
SNP Detail For snp_cf0017000000003    [See in GBrowse]
1.General Information
SNP ID: snp_cf0017000000003
Organism: Canis familiaris
Individual: DQ9
Create time: 2014-07-19
Last update: 2014-07-19
2.Allele Information
Platform: SOLEXA
Method: sequence
SNP Class: snp
Genotype: G
5'flank: CCTGAGTGTAGACGTAGCTAACACCCTCAT
3'flank: TTAGTGGCTGGGAGAGGTTTTGAGAAAAGC
3.Reference Map information
Chrom Position Reference DQ9
Chr1 8564 A G
4.Gene information
Gene model(s)
Gene ID Position in Gene Strands Gene Allele Location
NA NA NA NA NA
Transcript Protein
SNP to transcript Accession Position in Transcript Allele change Accession Position in Protein Residue change
NA NA NA NA NA NA NA
5.SNPs of other individuals in this position
SNP_ID Individual Genotype 5' Near Seq 30 bp 3' Near Seq 30 bp Create time Last update time
snp_cf0010000000004 DQ2 G CCTGAGTGTAGACGTAGCTAACACCCTCAT TTAGTGGCTGGGAGAGGTTTTGAGAAAAGC 2014-07-19 2014-07-19
snp_cf0074000000003 YJ5 G CCTGAGTGTAGACGTAGCTAACACCCTCAT TTAGTGGCTGGGAGAGGTTTTGAGAAAAGC 2014-07-19 2014-07-19
snp_cf0057000000003 LUPWRUS00002 G CCTGAGTGTAGACGTAGCTAACACCCTCAT TTAGTGGCTGGGAGAGGTTTTGAGAAAAGC 2014-07-19 2014-07-19
snp_cf0016000000004 DQ8 R CCTGAGTGTAGACGTAGCTAACACCCTCAT TTAGTGGCTGGGAGAGGTTTTGAGAAAAGC 2014-07-19 2014-07-19
snp_cf0039000000003 KM4 R CCTGAGTGTAGACGTAGCTAACACCCTCAT TTAGTGGCTGGGAGAGGTTTTGAGAAAAGC 2014-07-19 2014-07-19
snp_cf0051000000004 LJ6 R CCTGAGTGTAGACGTAGCTAACACCCTCAT TTAGTGGCTGGGAGAGGTTTTGAGAAAAGC 2014-07-19 2014-07-19
snp_cf0045000000003 LJ10 G CCTGAGTGTAGACGTAGCTAACACCCTCAT TTAGTGGCTGGGAGAGGTTTTGAGAAAAGC 2014-07-19 2014-07-19
snp_cf0077000000003 YJ8 G CCTGAGTGTAGACGTAGCTAACACCCTCAT TTAGTGGCTGGGAGAGGTTTTGAGAAAAGC 2014-07-19 2014-07-19
snp_cf0024000000003 GS10 G CCTGAGTGTAGACGTAGCTAACACCCTCAT TTAGTGGCTGGGAGAGGTTTTGAGAAAAGC 2014-07-19 2014-07-19
snp_cf0059000000001 TM10 G CCTGAGTGTAGACGTAGCTAACACCCTCAT TTAGTGGCTGGGAGAGGTTTTGAGAAAAGC 2014-07-19 2014-07-19
snp_cf0050000000003 LJ5 G CCTGAGTGTAGACGTAGCTAACACCCTCAT TTAGTGGCTGGGAGAGGTTTTGAGAAAAGC 2014-07-19 2014-07-19
snp_cf0015000000004 DQ7 G CCTGAGTGTAGACGTAGCTAACACCCTCAT TTAGTGGCTGGGAGAGGTTTTGAGAAAAGC 2014-07-19 2014-07-19
snp_cf0002000000034 CID1 G CCTGAGTGTAGACGTAGCTAACACCCTCAT TTAGTGGCTGGGAGAGGTTTTGAGAAAAGC 2014-08-02 2014-08-02
snp_cf0071000000003 YJ2 G CCTGAGTGTAGACGTAGCTAACACCCTCAT TTAGTGGCTGGGAGAGGTTTTGAGAAAAGC 2014-07-19 2014-07-19
snp_cf0053000000002 LJ8 G CCTGAGTGTAGACGTAGCTAACACCCTCAT TTAGTGGCTGGGAGAGGTTTTGAGAAAAGC 2014-07-19 2014-07-19
snp_cf0006000000003 CRW G CCTGAGTGTAGACGTAGCTAACACCCTCAT TTAGTGGCTGGGAGAGGTTTTGAGAAAAGC 2014-07-19 2014-07-19
snp_cf0035000000003 KM10 G CCTGAGTGTAGACGTAGCTAACACCCTCAT TTAGTGGCTGGGAGAGGTTTTGAGAAAAGC 2014-07-19 2014-07-19
snp_cf0076000000001 YJ7 G CCTGAGTGTAGACGTAGCTAACACCCTCAT TTAGTGGCTGGGAGAGGTTTTGAGAAAAGC 2014-07-19 2014-07-19
snp_cf0009000000004 DQ1 G CCTGAGTGTAGACGTAGCTAACACCCTCAT TTAGTGGCTGGGAGAGGTTTTGAGAAAAGC 2014-07-19 2014-07-19
snp_cf0023000000003 FAMICHN00003 G CCTGAGTGTAGACGTAGCTAACACCCTCAT TTAGTGGCTGGGAGAGGTTTTGAGAAAAGC 2014-07-19 2014-07-19
snp_cf0026000000003 GS2 G CCTGAGTGTAGACGTAGCTAACACCCTCAT TTAGTGGCTGGGAGAGGTTTTGAGAAAAGC 2014-07-19 2014-07-19
snp_cf0018000000001 FAMBBEM00001 R CCTGAGTGTAGACGTAGCTAACACCCTCAT TTAGTGGCTGGGAGAGGTTTTGAGAAAAGC 2014-07-19 2014-07-19
snp_cf0055000000003 LUPWCHN00001 G CCTGAGTGTAGACGTAGCTAACACCCTCAT TTAGTGGCTGGGAGAGGTTTTGAGAAAAGC 2014-07-19 2014-07-19
snp_cf0049000000004 LJ4 G CCTGAGTGTAGACGTAGCTAACACCCTCAT TTAGTGGCTGGGAGAGGTTTTGAGAAAAGC 2014-07-19 2014-07-19
snp_cf0058000000004 LUPWRUS00003 G CCTGAGTGTAGACGTAGCTAACACCCTCAT TTAGTGGCTGGGAGAGGTTTTGAGAAAAGC 2014-07-19 2014-07-19
snp_cf0073000000003 YJ4 G CCTGAGTGTAGACGTAGCTAACACCCTCAT TTAGTGGCTGGGAGAGGTTTTGAGAAAAGC 2014-07-19 2014-07-19
snp_cf0011000000003 DQ3 G CCTGAGTGTAGACGTAGCTAACACCCTCAT TTAGTGGCTGGGAGAGGTTTTGAGAAAAGC 2014-07-19 2014-07-19
snp_cf0040000000003 KM5 G CCTGAGTGTAGACGTAGCTAACACCCTCAT TTAGTGGCTGGGAGAGGTTTTGAGAAAAGC 2014-07-19 2014-07-19
snp_cf0005000000004 CHW G CCTGAGTGTAGACGTAGCTAACACCCTCAT TTAGTGGCTGGGAGAGGTTTTGAGAAAAGC 2014-07-19 2014-07-19
snp_cf0069000000003 YJ10 G CCTGAGTGTAGACGTAGCTAACACCCTCAT TTAGTGGCTGGGAGAGGTTTTGAGAAAAGC 2014-07-19 2014-07-19
snp_cf0001000000014 solidGW1 G CCTGAGTGTAGACGTAGCTAACACCCTCAT TTAGTGGCTGGGAGAGGTTTTGAGAAAAGC 2014-08-01 2014-08-01
snp_cf0014000000004 DQ6 G CCTGAGTGTAGACGTAGCTAACACCCTCAT TTAGTGGCTGGGAGAGGTTTTGAGAAAAGC 2014-07-19 2014-07-19
snp_cf0046000000003 LJ1 R CCTGAGTGTAGACGTAGCTAACACCCTCAT TTAGTGGCTGGGAGAGGTTTTGAGAAAAGC 2014-07-19 2014-07-19
snp_cf0078000000003 YJ9 G CCTGAGTGTAGACGTAGCTAACACCCTCAT TTAGTGGCTGGGAGAGGTTTTGAGAAAAGC 2014-07-19 2014-07-19
snp_cf0007000000003 Dingo G CCTGAGTGTAGACGTAGCTAACACCCTCAT TTAGTGGCTGGGAGAGGTTTTGAGAAAAGC 2014-07-19 2014-07-19
snp_cf0034000000004 ISW G CCTGAGTGTAGACGTAGCTAACACCCTCAT TTAGTGGCTGGGAGAGGTTTTGAGAAAAGC 2014-07-19 2014-07-19
snp_cf0066000000003 TM7 G CCTGAGTGTAGACGTAGCTAACACCCTCAT TTAGTGGCTGGGAGAGGTTTTGAGAAAAGC 2014-07-19 2014-07-19
snp_cf0025000000001 GS1 R CCTGAGTGTAGACGTAGCTAACACCCTCAT TTAGTGGCTGGGAGAGGTTTTGAGAAAAGC 2014-07-19 2014-07-19
snp_cf0075000000003 YJ6 G CCTGAGTGTAGACGTAGCTAACACCCTCAT TTAGTGGCTGGGAGAGGTTTTGAGAAAAGC 2014-07-19 2014-07-19
snp_cf0019000000003 FAMBGSD00001 G CCTGAGTGTAGACGTAGCTAACACCCTCAT TTAGTGGCTGGGAGAGGTTTTGAGAAAAGC 2014-07-19 2014-07-19
6.Fasta Information
CAGAACCCTC CCGCATCCTA CCTGAGTGTA GACGTAGCTA ACACCCTCAT
G
TTAGTGGCTG GGAGAGGTTT TGAGAAAAGC ATGTGGAATC GTTGTTCCTG