e.g. 1:1246..9423
SNP Detail For snp_cf0017000000005    [See in GBrowse]
1.General Information
SNP ID: snp_cf0017000000005
Organism: Canis familiaris
Individual: DQ9
Create time: 2014-07-19
Last update: 2014-07-19
2.Allele Information
Platform: SOLEXA
Method: sequence
SNP Class: snp
Genotype: A
5'flank: TCTGGCTACCATGCTTACTTCTGAGAGGTG
3'flank: GCTTACGGCCTGTACCTCCACATCCTGCCG
3.Reference Map information
Chrom Position Reference DQ9
Chr1 29873 T A
4.Gene information
Gene model(s)
Gene ID Position in Gene Strands Gene Allele Location
NA NA NA NA NA
Transcript Protein
SNP to transcript Accession Position in Transcript Allele change Accession Position in Protein Residue change
NA NA NA NA NA NA NA
5.SNPs of other individuals in this position
SNP_ID Individual Genotype 5' Near Seq 30 bp 3' Near Seq 30 bp Create time Last update time
snp_cf0010000000006 DQ2 A TCTGGCTACCATGCTTACTTCTGAGAGGTG GCTTACGGCCTGTACCTCCACATCCTGCCG 2014-07-19 2014-07-19
snp_cf0013000000003 DQ5 A TCTGGCTACCATGCTTACTTCTGAGAGGTG GCTTACGGCCTGTACCTCCACATCCTGCCG 2014-07-19 2014-07-19
snp_cf0022000000004 FAMICHN00002 A TCTGGCTACCATGCTTACTTCTGAGAGGTG GCTTACGGCCTGTACCTCCACATCCTGCCG 2014-07-19 2014-07-19
snp_cf0028000000002 GS4 A TCTGGCTACCATGCTTACTTCTGAGAGGTG GCTTACGGCCTGTACCTCCACATCCTGCCG 2014-07-19 2014-07-19
snp_cf0074000000005 YJ5 A TCTGGCTACCATGCTTACTTCTGAGAGGTG GCTTACGGCCTGTACCTCCACATCCTGCCG 2014-07-19 2014-07-19
snp_cf0068000000005 TM9 A TCTGGCTACCATGCTTACTTCTGAGAGGTG GCTTACGGCCTGTACCTCCACATCCTGCCG 2014-07-19 2014-07-19
snp_cf0007000000005 Dingo A TCTGGCTACCATGCTTACTTCTGAGAGGTG GCTTACGGCCTGTACCTCCACATCCTGCCG 2014-07-19 2014-07-19
snp_cf0004000000004 Basenji A TCTGGCTACCATGCTTACTTCTGAGAGGTG GCTTACGGCCTGTACCTCCACATCCTGCCG 2014-07-19 2014-07-19
snp_cf0059000000004 TM10 A TCTGGCTACCATGCTTACTTCTGAGAGGTG GCTTACGGCCTGTACCTCCACATCCTGCCG 2014-07-19 2014-07-19
snp_cf0056000000005 LUPWRUS00001 A TCTGGCTACCATGCTTACTTCTGAGAGGTG GCTTACGGCCTGTACCTCCACATCCTGCCG 2014-07-19 2014-07-19
snp_cf0053000000004 LJ8 A TCTGGCTACCATGCTTACTTCTGAGAGGTG GCTTACGGCCTGTACCTCCACATCCTGCCG 2014-07-19 2014-07-19
snp_cf0065000000003 TM6 A TCTGGCTACCATGCTTACTTCTGAGAGGTG GCTTACGGCCTGTACCTCCACATCCTGCCG 2014-07-19 2014-07-19
snp_cf0044000000003 KM9 A TCTGGCTACCATGCTTACTTCTGAGAGGTG GCTTACGGCCTGTACCTCCACATCCTGCCG 2014-07-19 2014-07-19
snp_cf0016000000011 DQ8 A TCTGGCTACCATGCTTACTTCTGAGAGGTG GCTTACGGCCTGTACCTCCACATCCTGCCG 2014-07-19 2014-07-19
snp_cf0071000000004 YJ2 A TCTGGCTACCATGCTTACTTCTGAGAGGTG GCTTACGGCCTGTACCTCCACATCCTGCCG 2014-07-19 2014-07-19
snp_cf0062000000002 TM3 A TCTGGCTACCATGCTTACTTCTGAGAGGTG GCTTACGGCCTGTACCTCCACATCCTGCCG 2014-07-19 2014-07-19
snp_cf0035000000006 KM10 A TCTGGCTACCATGCTTACTTCTGAGAGGTG GCTTACGGCCTGTACCTCCACATCCTGCCG 2014-07-19 2014-07-19
snp_cf0023000000008 FAMICHN00003 A TCTGGCTACCATGCTTACTTCTGAGAGGTG GCTTACGGCCTGTACCTCCACATCCTGCCG 2014-07-19 2014-07-19
snp_cf0041000000003 KM6 A TCTGGCTACCATGCTTACTTCTGAGAGGTG GCTTACGGCCTGTACCTCCACATCCTGCCG 2014-07-19 2014-07-19
snp_cf0064000000001 TM5 A TCTGGCTACCATGCTTACTTCTGAGAGGTG GCTTACGGCCTGTACCTCCACATCCTGCCG 2014-07-19 2014-07-19
snp_cf0058000000007 LUPWRUS00003 A TCTGGCTACCATGCTTACTTCTGAGAGGTG GCTTACGGCCTGTACCTCCACATCCTGCCG 2014-07-19 2014-07-19
snp_cf0069000000005 YJ10 A TCTGGCTACCATGCTTACTTCTGAGAGGTG GCTTACGGCCTGTACCTCCACATCCTGCCG 2014-07-19 2014-07-19
snp_cf0034000000007 ISW W TCTGGCTACCATGCTTACTTCTGAGAGGTG GCTTACGGCCTGTACCTCCACATCCTGCCG 2014-07-19 2014-07-19
snp_cf0040000000006 KM5 A TCTGGCTACCATGCTTACTTCTGAGAGGTG GCTTACGGCCTGTACCTCCACATCCTGCCG 2014-07-19 2014-07-19
snp_cf0070000000006 YJ1 A TCTGGCTACCATGCTTACTTCTGAGAGGTG GCTTACGGCCTGTACCTCCACATCCTGCCG 2014-07-19 2014-07-19
snp_cf0063000000002 TM4 W TCTGGCTACCATGCTTACTTCTGAGAGGTG GCTTACGGCCTGTACCTCCACATCCTGCCG 2014-07-19 2014-07-19
snp_cf0052000000005 LJ7 A TCTGGCTACCATGCTTACTTCTGAGAGGTG GCTTACGGCCTGTACCTCCACATCCTGCCG 2014-07-19 2014-07-19
snp_cf0046000000007 LJ1 W TCTGGCTACCATGCTTACTTCTGAGAGGTG GCTTACGGCCTGTACCTCCACATCCTGCCG 2014-07-19 2014-07-19
snp_cf0042000000007 KM7 A TCTGGCTACCATGCTTACTTCTGAGAGGTG GCTTACGGCCTGTACCTCCACATCCTGCCG 2014-07-19 2014-07-19
snp_cf0054000000003 LJ9 W TCTGGCTACCATGCTTACTTCTGAGAGGTG GCTTACGGCCTGTACCTCCACATCCTGCCG 2014-07-19 2014-07-19
snp_cf0048000000004 LJ3 W TCTGGCTACCATGCTTACTTCTGAGAGGTG GCTTACGGCCTGTACCTCCACATCCTGCCG 2014-07-19 2014-07-19
snp_cf0057000000007 LUPWRUS00002 A TCTGGCTACCATGCTTACTTCTGAGAGGTG GCTTACGGCCTGTACCTCCACATCCTGCCG 2014-07-19 2014-07-19
snp_cf0036000000004 KM1 W TCTGGCTACCATGCTTACTTCTGAGAGGTG GCTTACGGCCTGTACCTCCACATCCTGCCG 2014-07-19 2014-07-19
snp_cf0039000000006 KM4 A TCTGGCTACCATGCTTACTTCTGAGAGGTG GCTTACGGCCTGTACCTCCACATCCTGCCG 2014-07-19 2014-07-19
snp_cf0060000000006 TM1 A TCTGGCTACCATGCTTACTTCTGAGAGGTG GCTTACGGCCTGTACCTCCACATCCTGCCG 2014-07-19 2014-07-19
snp_cf0045000000004 LJ10 A TCTGGCTACCATGCTTACTTCTGAGAGGTG GCTTACGGCCTGTACCTCCACATCCTGCCG 2014-07-19 2014-07-19
snp_cf0021000000007 FAMICHN00001 W TCTGGCTACCATGCTTACTTCTGAGAGGTG GCTTACGGCCTGTACCTCCACATCCTGCCG 2014-07-19 2014-07-19
snp_cf0030000000001 GS6 A TCTGGCTACCATGCTTACTTCTGAGAGGTG GCTTACGGCCTGTACCTCCACATCCTGCCG 2014-07-19 2014-07-19
snp_cf0024000000005 GS10 A TCTGGCTACCATGCTTACTTCTGAGAGGTG GCTTACGGCCTGTACCTCCACATCCTGCCG 2014-07-19 2014-07-19
snp_cf0033000000002 GS9 A TCTGGCTACCATGCTTACTTCTGAGAGGTG GCTTACGGCCTGTACCTCCACATCCTGCCG 2014-07-19 2014-07-19
snp_cf0027000000006 GS3 A TCTGGCTACCATGCTTACTTCTGAGAGGTG GCTTACGGCCTGTACCTCCACATCCTGCCG 2014-07-19 2014-07-19
snp_cf0018000000004 FAMBBEM00001 A TCTGGCTACCATGCTTACTTCTGAGAGGTG GCTTACGGCCTGTACCTCCACATCCTGCCG 2014-07-19 2014-07-19
snp_cf0009000000009 DQ1 A TCTGGCTACCATGCTTACTTCTGAGAGGTG GCTTACGGCCTGTACCTCCACATCCTGCCG 2014-07-19 2014-07-19
snp_cf0029000000003 GS5 A TCTGGCTACCATGCTTACTTCTGAGAGGTG GCTTACGGCCTGTACCTCCACATCCTGCCG 2014-07-19 2014-07-19
snp_cf0012000000003 DQ4 A TCTGGCTACCATGCTTACTTCTGAGAGGTG GCTTACGGCCTGTACCTCCACATCCTGCCG 2014-07-19 2014-07-19
snp_cf0015000000008 DQ7 A TCTGGCTACCATGCTTACTTCTGAGAGGTG GCTTACGGCCTGTACCTCCACATCCTGCCG 2014-07-19 2014-07-19
snp_cf0006000000005 CRW A TCTGGCTACCATGCTTACTTCTGAGAGGTG GCTTACGGCCTGTACCTCCACATCCTGCCG 2014-07-19 2014-07-19
snp_cf0032000000003 GS8 A TCTGGCTACCATGCTTACTTCTGAGAGGTG GCTTACGGCCTGTACCTCCACATCCTGCCG 2014-07-19 2014-07-19
snp_cf0067000000002 TM8 A TCTGGCTACCATGCTTACTTCTGAGAGGTG GCTTACGGCCTGTACCTCCACATCCTGCCG 2014-07-19 2014-07-19
snp_cf0038000000004 KM3 W TCTGGCTACCATGCTTACTTCTGAGAGGTG GCTTACGGCCTGTACCTCCACATCCTGCCG 2014-07-19 2014-07-19
snp_cf0061000000001 TM2 W TCTGGCTACCATGCTTACTTCTGAGAGGTG GCTTACGGCCTGTACCTCCACATCCTGCCG 2014-07-19 2014-07-19
snp_cf0073000000005 YJ4 W TCTGGCTACCATGCTTACTTCTGAGAGGTG GCTTACGGCCTGTACCTCCACATCCTGCCG 2014-07-19 2014-07-19
snp_cf0055000000004 LUPWCHN00001 A TCTGGCTACCATGCTTACTTCTGAGAGGTG GCTTACGGCCTGTACCTCCACATCCTGCCG 2014-07-19 2014-07-19
snp_cf0026000000004 GS2 A TCTGGCTACCATGCTTACTTCTGAGAGGTG GCTTACGGCCTGTACCTCCACATCCTGCCG 2014-07-19 2014-07-19
snp_cf0049000000007 LJ4 W TCTGGCTACCATGCTTACTTCTGAGAGGTG GCTTACGGCCTGTACCTCCACATCCTGCCG 2014-07-19 2014-07-19
snp_cf0078000000005 YJ9 A TCTGGCTACCATGCTTACTTCTGAGAGGTG GCTTACGGCCTGTACCTCCACATCCTGCCG 2014-07-19 2014-07-19
snp_cf0031000000006 GS7 A TCTGGCTACCATGCTTACTTCTGAGAGGTG GCTTACGGCCTGTACCTCCACATCCTGCCG 2014-07-19 2014-07-19
snp_cf0037000000003 KM2 W TCTGGCTACCATGCTTACTTCTGAGAGGTG GCTTACGGCCTGTACCTCCACATCCTGCCG 2014-07-19 2014-07-19
snp_cf0014000000007 DQ6 A TCTGGCTACCATGCTTACTTCTGAGAGGTG GCTTACGGCCTGTACCTCCACATCCTGCCG 2014-07-19 2014-07-19
snp_cf0050000000010 LJ5 W TCTGGCTACCATGCTTACTTCTGAGAGGTG GCTTACGGCCTGTACCTCCACATCCTGCCG 2014-07-19 2014-07-19
snp_cf0020000000005 FAMBTIM00001 A TCTGGCTACCATGCTTACTTCTGAGAGGTG GCTTACGGCCTGTACCTCCACATCCTGCCG 2014-07-19 2014-07-19
snp_cf0025000000004 GS1 A TCTGGCTACCATGCTTACTTCTGAGAGGTG GCTTACGGCCTGTACCTCCACATCCTGCCG 2014-07-19 2014-07-19
snp_cf0043000000004 KM8 A TCTGGCTACCATGCTTACTTCTGAGAGGTG GCTTACGGCCTGTACCTCCACATCCTGCCG 2014-07-19 2014-07-19
snp_cf0019000000004 FAMBGSD00001 A TCTGGCTACCATGCTTACTTCTGAGAGGTG GCTTACGGCCTGTACCTCCACATCCTGCCG 2014-07-19 2014-07-19
6.Fasta Information
GTACTAGTGG GTAGCAGACA TCTGGCTACC ATGCTTACTT CTGAGAGGTG
A
GCTTACGGCC TGTACCTCCA CATCCTGCCG GCAGTTACCC TTCGCTTCTA