e.g. 1:1246..9423
SNP Detail For snp_cf0017000000009    [See in GBrowse]
1.General Information
SNP ID: snp_cf0017000000009
Organism: Canis familiaris
Individual: DQ9
Create time: 2014-07-19
Last update: 2014-07-19
2.Allele Information
Platform: SOLEXA
Method: sequence
SNP Class: snp
Genotype: T
5'flank: AGAATGAGTTTCGAACATGTTGACCAGAGA
3'flank: GTTTTTCAGAAACTGGAGAGACGCAAGTGG
3.Reference Map information
Chrom Position Reference DQ9
Chr1 33333 C T
4.Gene information
Gene model(s)
Gene ID Position in Gene Strands Gene Allele Location
NA NA NA NA NA
Transcript Protein
SNP to transcript Accession Position in Transcript Allele change Accession Position in Protein Residue change
NA NA NA NA NA NA NA
5.SNPs of other individuals in this position
SNP_ID Individual Genotype 5' Near Seq 30 bp 3' Near Seq 30 bp Create time Last update time
snp_cf0053000000007 LJ8 Y AGAATGAGTTTCGAACATGTTGACCAGAGA GTTTTTCAGAAACTGGAGAGACGCAAGTGG 2014-07-19 2014-07-19
6.Fasta Information
CCCACCGTTC CAACTGCCTC AGAATGAGTT TCGAACATGT TGACCAGAGA
T
GTTTTTCAGA AACTGGAGAG ACGCAAGTGG AATAATGGAG GCATGGAAAG