e.g. 1:1246..9423
SNP Detail For snp_cf0018000304597    [See in GBrowse]
1.General Information
SNP ID: snp_cf0018000304597
Organism: Canis familiaris
Individual: FAMBBEM00001
Create time: 2014-07-19
Last update: 2014-07-19
2.Allele Information
Platform: SOLEXA
Method: sequence
SNP Class: snp
Genotype: R
5'flank: AGATGGAAGCCATTGTCCAGGATGCCCAGA
3'flank: CCTGTTCAATCTGGAAACGTCCGTGGTTGT
3.Reference Map information
Chrom Position Reference FAMBBEM00001
Chr11 242763 G R
4.Gene information
Gene model(s)
Gene ID Position in Gene Strands Gene Allele Location
ENSCAFG00000012915 8141 + G CDS
Transcript Protein
SNP to transcript Accession Position in Transcript Allele change Accession Position in Protein Residue change
+ ENSCAFT00000020494 626 AGC => AAC ENSCAFP00000019020 209 S => N
+ ENSCAFT00000020497 626 AGC => AAC ENSCAFP00000019022 209 S => N
5.SNPs of other individuals in this position
SNP_ID Individual Genotype 5' Near Seq 30 bp 3' Near Seq 30 bp Create time Last update time
snp_cf0039000287814 KM4 R AGATGGAAGCCATTGTCCAGGATGCCCAGA CCTGTTCAATCTGGAAACGTCCGTGGTTGT 2014-07-19 2014-07-19
snp_cf0020000366377 FAMBTIM00001 R AGATGGAAGCCATTGTCCAGGATGCCCAGA CCTGTTCAATCTGGAAACGTCCGTGGTTGT 2014-07-19 2014-07-19
snp_cf0076000379686 YJ7 R AGATGGAAGCCATTGTCCAGGATGCCCAGA CCTGTTCAATCTGGAAACGTCCGTGGTTGT 2014-07-19 2014-07-19
snp_cf0038000293725 KM3 A AGATGGAAGCCATTGTCCAGGATGCCCAGA CCTGTTCAATCTGGAAACGTCCGTGGTTGT 2014-07-19 2014-07-19
snp_cf0029000237423 GS5 A AGATGGAAGCCATTGTCCAGGATGCCCAGA CCTGTTCAATCTGGAAACGTCCGTGGTTGT 2014-07-19 2014-07-19
snp_cf0027000284432 GS3 R AGATGGAAGCCATTGTCCAGGATGCCCAGA CCTGTTCAATCTGGAAACGTCCGTGGTTGT 2014-07-19 2014-07-19
snp_cf0043000314915 KM8 R AGATGGAAGCCATTGTCCAGGATGCCCAGA CCTGTTCAATCTGGAAACGTCCGTGGTTGT 2014-07-19 2014-07-19
snp_cf0069000380685 YJ10 R AGATGGAAGCCATTGTCCAGGATGCCCAGA CCTGTTCAATCTGGAAACGTCCGTGGTTGT 2014-07-19 2014-07-19
snp_cf0037000314140 KM2 R AGATGGAAGCCATTGTCCAGGATGCCCAGA CCTGTTCAATCTGGAAACGTCCGTGGTTGT 2014-07-19 2014-07-19
snp_cf0033000302215 GS9 R AGATGGAAGCCATTGTCCAGGATGCCCAGA CCTGTTCAATCTGGAAACGTCCGTGGTTGT 2014-07-19 2014-07-19
snp_cf0066000375966 TM7 R AGATGGAAGCCATTGTCCAGGATGCCCAGA CCTGTTCAATCTGGAAACGTCCGTGGTTGT 2014-07-19 2014-07-19
snp_cf0007000301995 Dingo A AGATGGAAGCCATTGTCCAGGATGCCCAGA CCTGTTCAATCTGGAAACGTCCGTGGTTGT 2014-07-19 2014-07-19
snp_cf0011000372590 DQ3 R AGATGGAAGCCATTGTCCAGGATGCCCAGA CCTGTTCAATCTGGAAACGTCCGTGGTTGT 2014-07-19 2014-07-19
snp_cf0004000302253 Basenji R AGATGGAAGCCATTGTCCAGGATGCCCAGA CCTGTTCAATCTGGAAACGTCCGTGGTTGT 2014-07-19 2014-07-19
snp_cf0058000470105 LUPWRUS00003 R AGATGGAAGCCATTGTCCAGGATGCCCAGA CCTGTTCAATCTGGAAACGTCCGTGGTTGT 2014-07-19 2014-07-19
snp_cf0035000348914 KM10 R AGATGGAAGCCATTGTCCAGGATGCCCAGA CCTGTTCAATCTGGAAACGTCCGTGGTTGT 2014-07-19 2014-07-19
snp_cf0036000298365 KM1 A AGATGGAAGCCATTGTCCAGGATGCCCAGA CCTGTTCAATCTGGAAACGTCCGTGGTTGT 2014-07-19 2014-07-19
snp_cf0044000325009 KM9 R AGATGGAAGCCATTGTCCAGGATGCCCAGA CCTGTTCAATCTGGAAACGTCCGTGGTTGT 2014-07-19 2014-07-19
snp_cf0046000335979 LJ1 R AGATGGAAGCCATTGTCCAGGATGCCCAGA CCTGTTCAATCTGGAAACGTCCGTGGTTGT 2014-07-19 2014-07-19
snp_cf0040000309874 KM5 R AGATGGAAGCCATTGTCCAGGATGCCCAGA CCTGTTCAATCTGGAAACGTCCGTGGTTGT 2014-07-19 2014-07-19
snp_cf0017000381087 DQ9 A AGATGGAAGCCATTGTCCAGGATGCCCAGA CCTGTTCAATCTGGAAACGTCCGTGGTTGT 2014-07-19 2014-07-19
6.Fasta Information
AGGACAGTGC CTGTCTCCAG AGATGGAAGC CATTGTCCAG GATGCCCAGA
R
CCTGTTCAAT CTGGAAACGT CCGTGGTTGT CCAAGGGGAT GCCCACAACA