e.g. 1:1246..9423
SNP Detail For snp_cf0018000305460    [See in GBrowse]
1.General Information
SNP ID: snp_cf0018000305460
Organism: Canis familiaris
Individual: FAMBBEM00001
Create time: 2014-07-19
Last update: 2014-07-19
2.Allele Information
Platform: SOLEXA
Method: sequence
SNP Class: snp
Genotype: C
5'flank: AGACCAGGGTGCCATAGTTCTCCAGCATCA
3'flank: CTCCCGGTACAACATTCTCTGTGCAGAGTC
3.Reference Map information
Chrom Position Reference FAMBBEM00001
Chr11 2549281 A C
4.Gene information
Gene model(s)
Gene ID Position in Gene Strands Gene Allele Location
ENSCAFG00000030461 91 - A CDS
Transcript Protein
SNP to transcript Accession Position in Transcript Allele change Accession Position in Protein Residue change
- ENSCAFT00000047552 16 TTG => GTG ENSCAFP00000036614 6 L => V
5.SNPs of other individuals in this position
SNP_ID Individual Genotype 5' Near Seq 30 bp 3' Near Seq 30 bp Create time Last update time
snp_cf0038000294703 KM3 C AGACCAGGGTGCCATAGTTCTCCAGCATCA CTCCCGGTACAACATTCTCTGTGCAGAGTC 2014-07-19 2014-07-19
snp_cf0004000302808 Basenji C AGACCAGGGTGCCATAGTTCTCCAGCATCA CTCCCGGTACAACATTCTCTGTGCAGAGTC 2014-07-19 2014-07-19
snp_cf0047000343680 LJ2 C AGACCAGGGTGCCATAGTTCTCCAGCATCA CTCCCGGTACAACATTCTCTGTGCAGAGTC 2014-07-19 2014-07-19
snp_cf0001000194899 solidGW1 C AGACCAGGGTGCCATAGTTCTCCAGCATCA CTCCCGGTACAACATTCTCTGTGCAGAGTC 2014-08-01 2014-08-01
snp_cf0021000353107 FAMICHN00001 C AGACCAGGGTGCCATAGTTCTCCAGCATCA CTCCCGGTACAACATTCTCTGTGCAGAGTC 2014-07-19 2014-07-19
snp_cf0012000365243 DQ4 C AGACCAGGGTGCCATAGTTCTCCAGCATCA CTCCCGGTACAACATTCTCTGTGCAGAGTC 2014-07-19 2014-07-19
snp_cf0029000238280 GS5 C AGACCAGGGTGCCATAGTTCTCCAGCATCA CTCCCGGTACAACATTCTCTGTGCAGAGTC 2014-07-19 2014-07-19
snp_cf0042000359234 KM7 C AGACCAGGGTGCCATAGTTCTCCAGCATCA CTCCCGGTACAACATTCTCTGTGCAGAGTC 2014-07-19 2014-07-19
snp_cf0002000241018 CID1 C AGACCAGGGTGCCATAGTTCTCCAGCATCA CTCCCGGTACAACATTCTCTGTGCAGAGTC 2014-08-02 2014-08-02
snp_cf0015000371327 DQ7 C AGACCAGGGTGCCATAGTTCTCCAGCATCA CTCCCGGTACAACATTCTCTGTGCAGAGTC 2014-07-19 2014-07-19
snp_cf0045000309941 LJ10 C AGACCAGGGTGCCATAGTTCTCCAGCATCA CTCCCGGTACAACATTCTCTGTGCAGAGTC 2014-07-19 2014-07-19
snp_cf0059000374651 TM10 C AGACCAGGGTGCCATAGTTCTCCAGCATCA CTCCCGGTACAACATTCTCTGTGCAGAGTC 2014-07-19 2014-07-19
snp_cf0062000376590 TM3 C AGACCAGGGTGCCATAGTTCTCCAGCATCA CTCCCGGTACAACATTCTCTGTGCAGAGTC 2014-07-19 2014-07-19
snp_cf0037000315049 KM2 C AGACCAGGGTGCCATAGTTCTCCAGCATCA CTCCCGGTACAACATTCTCTGTGCAGAGTC 2014-07-19 2014-07-19
snp_cf0054000328660 LJ9 C AGACCAGGGTGCCATAGTTCTCCAGCATCA CTCCCGGTACAACATTCTCTGTGCAGAGTC 2014-07-19 2014-07-19
snp_cf0009000370710 DQ1 C AGACCAGGGTGCCATAGTTCTCCAGCATCA CTCCCGGTACAACATTCTCTGTGCAGAGTC 2014-07-19 2014-07-19
snp_cf0070000390899 YJ1 C AGACCAGGGTGCCATAGTTCTCCAGCATCA CTCCCGGTACAACATTCTCTGTGCAGAGTC 2014-07-19 2014-07-19
snp_cf0071000375188 YJ2 C AGACCAGGGTGCCATAGTTCTCCAGCATCA CTCCCGGTACAACATTCTCTGTGCAGAGTC 2014-07-19 2014-07-19
snp_cf0034000450326 ISW C AGACCAGGGTGCCATAGTTCTCCAGCATCA CTCCCGGTACAACATTCTCTGTGCAGAGTC 2014-07-19 2014-07-19
snp_cf0017000382487 DQ9 C AGACCAGGGTGCCATAGTTCTCCAGCATCA CTCCCGGTACAACATTCTCTGTGCAGAGTC 2014-07-19 2014-07-19
snp_cf0020000367148 FAMBTIM00001 C AGACCAGGGTGCCATAGTTCTCCAGCATCA CTCCCGGTACAACATTCTCTGTGCAGAGTC 2014-07-19 2014-07-19
snp_cf0061000375125 TM2 C AGACCAGGGTGCCATAGTTCTCCAGCATCA CTCCCGGTACAACATTCTCTGTGCAGAGTC 2014-07-19 2014-07-19
snp_cf0064000378614 TM5 C AGACCAGGGTGCCATAGTTCTCCAGCATCA CTCCCGGTACAACATTCTCTGTGCAGAGTC 2014-07-19 2014-07-19
snp_cf0013000375993 DQ5 C AGACCAGGGTGCCATAGTTCTCCAGCATCA CTCCCGGTACAACATTCTCTGTGCAGAGTC 2014-07-19 2014-07-19
snp_cf0068000356563 TM9 C AGACCAGGGTGCCATAGTTCTCCAGCATCA CTCCCGGTACAACATTCTCTGTGCAGAGTC 2014-07-19 2014-07-19
snp_cf0066000377219 TM7 C AGACCAGGGTGCCATAGTTCTCCAGCATCA CTCCCGGTACAACATTCTCTGTGCAGAGTC 2014-07-19 2014-07-19
snp_cf0078000382125 YJ9 C AGACCAGGGTGCCATAGTTCTCCAGCATCA CTCCCGGTACAACATTCTCTGTGCAGAGTC 2014-07-19 2014-07-19
snp_cf0063000371178 TM4 C AGACCAGGGTGCCATAGTTCTCCAGCATCA CTCCCGGTACAACATTCTCTGTGCAGAGTC 2014-07-19 2014-07-19
snp_cf0010000371170 DQ2 C AGACCAGGGTGCCATAGTTCTCCAGCATCA CTCCCGGTACAACATTCTCTGTGCAGAGTC 2014-07-19 2014-07-19
snp_cf0056000476871 LUPWRUS00001 C AGACCAGGGTGCCATAGTTCTCCAGCATCA CTCCCGGTACAACATTCTCTGTGCAGAGTC 2014-07-19 2014-07-19
snp_cf0069000381972 YJ10 C AGACCAGGGTGCCATAGTTCTCCAGCATCA CTCCCGGTACAACATTCTCTGTGCAGAGTC 2014-07-19 2014-07-19
snp_cf0007000302686 Dingo C AGACCAGGGTGCCATAGTTCTCCAGCATCA CTCCCGGTACAACATTCTCTGTGCAGAGTC 2014-07-19 2014-07-19
snp_cf0052000355713 LJ7 C AGACCAGGGTGCCATAGTTCTCCAGCATCA CTCCCGGTACAACATTCTCTGTGCAGAGTC 2014-07-19 2014-07-19
snp_cf0074000376540 YJ5 C AGACCAGGGTGCCATAGTTCTCCAGCATCA CTCCCGGTACAACATTCTCTGTGCAGAGTC 2014-07-19 2014-07-19
snp_cf0067000363915 TM8 C AGACCAGGGTGCCATAGTTCTCCAGCATCA CTCCCGGTACAACATTCTCTGTGCAGAGTC 2014-07-19 2014-07-19
snp_cf0032000274427 GS8 C AGACCAGGGTGCCATAGTTCTCCAGCATCA CTCCCGGTACAACATTCTCTGTGCAGAGTC 2014-07-19 2014-07-19
snp_cf0058000472290 LUPWRUS00003 C AGACCAGGGTGCCATAGTTCTCCAGCATCA CTCCCGGTACAACATTCTCTGTGCAGAGTC 2014-07-19 2014-07-19
snp_cf0031000293956 GS7 C AGACCAGGGTGCCATAGTTCTCCAGCATCA CTCCCGGTACAACATTCTCTGTGCAGAGTC 2014-07-19 2014-07-19
snp_cf0040000311090 KM5 C AGACCAGGGTGCCATAGTTCTCCAGCATCA CTCCCGGTACAACATTCTCTGTGCAGAGTC 2014-07-19 2014-07-19
snp_cf0076000380864 YJ7 C AGACCAGGGTGCCATAGTTCTCCAGCATCA CTCCCGGTACAACATTCTCTGTGCAGAGTC 2014-07-19 2014-07-19
snp_cf0046000337005 LJ1 C AGACCAGGGTGCCATAGTTCTCCAGCATCA CTCCCGGTACAACATTCTCTGTGCAGAGTC 2014-07-19 2014-07-19
snp_cf0057000459743 LUPWRUS00002 C AGACCAGGGTGCCATAGTTCTCCAGCATCA CTCCCGGTACAACATTCTCTGTGCAGAGTC 2014-07-19 2014-07-19
snp_cf0035000349961 KM10 C AGACCAGGGTGCCATAGTTCTCCAGCATCA CTCCCGGTACAACATTCTCTGTGCAGAGTC 2014-07-19 2014-07-19
snp_cf0048000346145 LJ3 C AGACCAGGGTGCCATAGTTCTCCAGCATCA CTCCCGGTACAACATTCTCTGTGCAGAGTC 2014-07-19 2014-07-19
snp_cf0053000363268 LJ8 C AGACCAGGGTGCCATAGTTCTCCAGCATCA CTCCCGGTACAACATTCTCTGTGCAGAGTC 2014-07-19 2014-07-19
snp_cf0028000272566 GS4 C AGACCAGGGTGCCATAGTTCTCCAGCATCA CTCCCGGTACAACATTCTCTGTGCAGAGTC 2014-07-19 2014-07-19
snp_cf0008000362906 DQ10 C AGACCAGGGTGCCATAGTTCTCCAGCATCA CTCCCGGTACAACATTCTCTGTGCAGAGTC 2014-07-19 2014-07-19
snp_cf0030000292236 GS6 C AGACCAGGGTGCCATAGTTCTCCAGCATCA CTCCCGGTACAACATTCTCTGTGCAGAGTC 2014-07-19 2014-07-19
snp_cf0055000470876 LUPWCHN00001 C AGACCAGGGTGCCATAGTTCTCCAGCATCA CTCCCGGTACAACATTCTCTGTGCAGAGTC 2014-07-19 2014-07-19
snp_cf0033000303221 GS9 C AGACCAGGGTGCCATAGTTCTCCAGCATCA CTCCCGGTACAACATTCTCTGTGCAGAGTC 2014-07-19 2014-07-19
snp_cf0011000373673 DQ3 C AGACCAGGGTGCCATAGTTCTCCAGCATCA CTCCCGGTACAACATTCTCTGTGCAGAGTC 2014-07-19 2014-07-19
snp_cf0065000351672 TM6 C AGACCAGGGTGCCATAGTTCTCCAGCATCA CTCCCGGTACAACATTCTCTGTGCAGAGTC 2014-07-19 2014-07-19
snp_cf0051000366027 LJ6 C AGACCAGGGTGCCATAGTTCTCCAGCATCA CTCCCGGTACAACATTCTCTGTGCAGAGTC 2014-07-19 2014-07-19
snp_cf0005000447082 CHW C AGACCAGGGTGCCATAGTTCTCCAGCATCA CTCCCGGTACAACATTCTCTGTGCAGAGTC 2014-07-19 2014-07-19
snp_cf0041000347733 KM6 C AGACCAGGGTGCCATAGTTCTCCAGCATCA CTCCCGGTACAACATTCTCTGTGCAGAGTC 2014-07-19 2014-07-19
snp_cf0014000360254 DQ6 C AGACCAGGGTGCCATAGTTCTCCAGCATCA CTCCCGGTACAACATTCTCTGTGCAGAGTC 2014-07-19 2014-07-19
snp_cf0043000315921 KM8 C AGACCAGGGTGCCATAGTTCTCCAGCATCA CTCCCGGTACAACATTCTCTGTGCAGAGTC 2014-07-19 2014-07-19
snp_cf0016000372447 DQ8 C AGACCAGGGTGCCATAGTTCTCCAGCATCA CTCCCGGTACAACATTCTCTGTGCAGAGTC 2014-07-19 2014-07-19
snp_cf0019000287555 FAMBGSD00001 C AGACCAGGGTGCCATAGTTCTCCAGCATCA CTCCCGGTACAACATTCTCTGTGCAGAGTC 2014-07-19 2014-07-19
snp_cf0025000271924 GS1 C AGACCAGGGTGCCATAGTTCTCCAGCATCA CTCCCGGTACAACATTCTCTGTGCAGAGTC 2014-07-19 2014-07-19
snp_cf0006000428046 CRW C AGACCAGGGTGCCATAGTTCTCCAGCATCA CTCCCGGTACAACATTCTCTGTGCAGAGTC 2014-07-19 2014-07-19
snp_cf0036000299241 KM1 C AGACCAGGGTGCCATAGTTCTCCAGCATCA CTCCCGGTACAACATTCTCTGTGCAGAGTC 2014-07-19 2014-07-19
snp_cf0027000285337 GS3 C AGACCAGGGTGCCATAGTTCTCCAGCATCA CTCCCGGTACAACATTCTCTGTGCAGAGTC 2014-07-19 2014-07-19
snp_cf0039000288766 KM4 C AGACCAGGGTGCCATAGTTCTCCAGCATCA CTCCCGGTACAACATTCTCTGTGCAGAGTC 2014-07-19 2014-07-19
snp_cf0023000340566 FAMICHN00003 C AGACCAGGGTGCCATAGTTCTCCAGCATCA CTCCCGGTACAACATTCTCTGTGCAGAGTC 2014-07-19 2014-07-19
snp_cf0077000376225 YJ8 C AGACCAGGGTGCCATAGTTCTCCAGCATCA CTCCCGGTACAACATTCTCTGTGCAGAGTC 2014-07-19 2014-07-19
snp_cf0075000384021 YJ6 C AGACCAGGGTGCCATAGTTCTCCAGCATCA CTCCCGGTACAACATTCTCTGTGCAGAGTC 2014-07-19 2014-07-19
snp_cf0026000286977 GS2 C AGACCAGGGTGCCATAGTTCTCCAGCATCA CTCCCGGTACAACATTCTCTGTGCAGAGTC 2014-07-19 2014-07-19
snp_cf0073000383040 YJ4 C AGACCAGGGTGCCATAGTTCTCCAGCATCA CTCCCGGTACAACATTCTCTGTGCAGAGTC 2014-07-19 2014-07-19
snp_cf0050000331607 LJ5 C AGACCAGGGTGCCATAGTTCTCCAGCATCA CTCCCGGTACAACATTCTCTGTGCAGAGTC 2014-07-19 2014-07-19
snp_cf0049000375422 LJ4 C AGACCAGGGTGCCATAGTTCTCCAGCATCA CTCCCGGTACAACATTCTCTGTGCAGAGTC 2014-07-19 2014-07-19
snp_cf0060000377838 TM1 C AGACCAGGGTGCCATAGTTCTCCAGCATCA CTCCCGGTACAACATTCTCTGTGCAGAGTC 2014-07-19 2014-07-19
snp_cf0024000313181 GS10 C AGACCAGGGTGCCATAGTTCTCCAGCATCA CTCCCGGTACAACATTCTCTGTGCAGAGTC 2014-07-19 2014-07-19
snp_cf0072000382225 YJ3 C AGACCAGGGTGCCATAGTTCTCCAGCATCA CTCCCGGTACAACATTCTCTGTGCAGAGTC 2014-07-19 2014-07-19
snp_cf0044000325774 KM9 C AGACCAGGGTGCCATAGTTCTCCAGCATCA CTCCCGGTACAACATTCTCTGTGCAGAGTC 2014-07-19 2014-07-19
6.Fasta Information
GCAGATGTCC TTACCCAGCG AGACCAGGGT GCCATAGTTC TCCAGCATCA
C
CTCCCGGTAC AACATTCTCT GTGCAGAGTC CAGGTGCAGC TACTCGTCCT