e.g. 1:1246..9423
SNP Detail For snp_cf0018000552197    [See in GBrowse]
1.General Information
SNP ID: snp_cf0018000552197
Organism: Canis familiaris
Individual: FAMBBEM00001
Create time: 2014-07-19
Last update: 2014-07-19
2.Allele Information
Platform: SOLEXA
Method: sequence
SNP Class: snp
Genotype: Y
5'flank: GACCGACGGGAGGCCACAGGACTCCGTGGC
3'flank: GAGGTGGCTGCCAAGGCACGTGACACAGGC
3.Reference Map information
Chrom Position Reference FAMBBEM00001
Chr13 192913 C Y
4.Gene information
Gene model(s)
Gene ID Position in Gene Strands Gene Allele Location
ENSCAFG00000013852 43597 + C CDS
Transcript Protein
SNP to transcript Accession Position in Transcript Allele change Accession Position in Protein Residue change
+ ENSCAFT00000000737 537 GCC => GCT ENSCAFP00000000680 179 A => A
+ ENSCAFT00000021976 537 GCC => GCT ENSCAFP00000020407 179 A => A
5.SNPs of other individuals in this position
SNP_ID Individual Genotype 5' Near Seq 30 bp 3' Near Seq 30 bp Create time Last update time
snp_cf0005000813447 CHW Y GACCGACGGGAGGCCACAGGACTCCGTGGC GAGGTGGCTGCCAAGGCACGTGACACAGGC 2014-07-19 2014-07-19
snp_cf0001000300853 solidGW1 Y GACCGACGGGAGGCCACAGGACTCCGTGGC GAGGTGGCTGCCAAGGCACGTGACACAGGC 2014-08-01 2014-08-01
snp_cf0055000832136 LUPWCHN00001 Y GACCGACGGGAGGCCACAGGACTCCGTGGC GAGGTGGCTGCCAAGGCACGTGACACAGGC 2014-07-19 2014-07-19
6.Fasta Information
CTGCGGGTCA TAATGATTGT GACCGACGGG AGGCCACAGG ACTCCGTGGC
Y
GAGGTGGCTG CCAAGGCACG TGACACAGGC ATCCTGATCT TTGCCATCGG