e.g. 1:1246..9423
SNP Detail For snp_cf0018000552304    [See in GBrowse]
1.General Information
SNP ID: snp_cf0018000552304
Organism: Canis familiaris
Individual: FAMBBEM00001
Create time: 2014-07-19
Last update: 2014-07-19
2.Allele Information
Platform: SOLEXA
Method: sequence
SNP Class: snp
Genotype: Y
5'flank: CCTCGGCCCCGTCTCACTCACCGTCTTCTT
3'flank: GCGGCCACCATCTTCCTGCCTTAGATGCGG
3.Reference Map information
Chrom Position Reference FAMBBEM00001
Chr13 304574 C Y
4.Gene information
Gene model(s)
Gene ID Position in Gene Strands Gene Allele Location
ENSCAFG00000031952 12 - C CDS
Transcript Protein
SNP to transcript Accession Position in Transcript Allele change Accession Position in Protein Residue change
- ENSCAFT00000049021 12 GCG => GCA ENSCAFP00000036726 4 A => A
5.SNPs of other individuals in this position
SNP_ID Individual Genotype 5' Near Seq 30 bp 3' Near Seq 30 bp Create time Last update time
snp_cf0049000663775 LJ4 Y CCTCGGCCCCGTCTCACTCACCGTCTTCTT GCGGCCACCATCTTCCTGCCTTAGATGCGG 2014-07-19 2014-07-19
snp_cf0077000675922 YJ8 Y CCTCGGCCCCGTCTCACTCACCGTCTTCTT GCGGCCACCATCTTCCTGCCTTAGATGCGG 2014-07-19 2014-07-19
snp_cf0069000684578 YJ10 Y CCTCGGCCCCGTCTCACTCACCGTCTTCTT GCGGCCACCATCTTCCTGCCTTAGATGCGG 2014-07-19 2014-07-19
snp_cf0075000684131 YJ6 T CCTCGGCCCCGTCTCACTCACCGTCTTCTT GCGGCCACCATCTTCCTGCCTTAGATGCGG 2014-07-19 2014-07-19
snp_cf0063000654165 TM4 Y CCTCGGCCCCGTCTCACTCACCGTCTTCTT GCGGCCACCATCTTCCTGCCTTAGATGCGG 2014-07-19 2014-07-19
snp_cf0061000675351 TM2 T CCTCGGCCCCGTCTCACTCACCGTCTTCTT GCGGCCACCATCTTCCTGCCTTAGATGCGG 2014-07-19 2014-07-19
snp_cf0012000662154 DQ4 T CCTCGGCCCCGTCTCACTCACCGTCTTCTT GCGGCCACCATCTTCCTGCCTTAGATGCGG 2014-07-19 2014-07-19
snp_cf0027000515568 GS3 Y CCTCGGCCCCGTCTCACTCACCGTCTTCTT GCGGCCACCATCTTCCTGCCTTAGATGCGG 2014-07-19 2014-07-19
snp_cf0055000832319 LUPWCHN00001 T CCTCGGCCCCGTCTCACTCACCGTCTTCTT GCGGCCACCATCTTCCTGCCTTAGATGCGG 2014-07-19 2014-07-19
snp_cf0005000813551 CHW T CCTCGGCCCCGTCTCACTCACCGTCTTCTT GCGGCCACCATCTTCCTGCCTTAGATGCGG 2014-07-19 2014-07-19
snp_cf0067000641332 TM8 T CCTCGGCCCCGTCTCACTCACCGTCTTCTT GCGGCCACCATCTTCCTGCCTTAGATGCGG 2014-07-19 2014-07-19
snp_cf0039000509350 KM4 Y CCTCGGCCCCGTCTCACTCACCGTCTTCTT GCGGCCACCATCTTCCTGCCTTAGATGCGG 2014-07-19 2014-07-19
snp_cf0009000664063 DQ1 Y CCTCGGCCCCGTCTCACTCACCGTCTTCTT GCGGCCACCATCTTCCTGCCTTAGATGCGG 2014-07-19 2014-07-19
snp_cf0042000664120 KM7 Y CCTCGGCCCCGTCTCACTCACCGTCTTCTT GCGGCCACCATCTTCCTGCCTTAGATGCGG 2014-07-19 2014-07-19
snp_cf0070000697395 YJ1 Y CCTCGGCCCCGTCTCACTCACCGTCTTCTT GCGGCCACCATCTTCCTGCCTTAGATGCGG 2014-07-19 2014-07-19
snp_cf0057000816572 LUPWRUS00002 Y CCTCGGCCCCGTCTCACTCACCGTCTTCTT GCGGCCACCATCTTCCTGCCTTAGATGCGG 2014-07-19 2014-07-19
snp_cf0032000502037 GS8 T CCTCGGCCCCGTCTCACTCACCGTCTTCTT GCGGCCACCATCTTCCTGCCTTAGATGCGG 2014-07-19 2014-07-19
snp_cf0056000840922 LUPWRUS00001 T CCTCGGCCCCGTCTCACTCACCGTCTTCTT GCGGCCACCATCTTCCTGCCTTAGATGCGG 2014-07-19 2014-07-19
snp_cf0078000676898 YJ9 Y CCTCGGCCCCGTCTCACTCACCGTCTTCTT GCGGCCACCATCTTCCTGCCTTAGATGCGG 2014-07-19 2014-07-19
snp_cf0013000632985 DQ5 Y CCTCGGCCCCGTCTCACTCACCGTCTTCTT GCGGCCACCATCTTCCTGCCTTAGATGCGG 2014-07-19 2014-07-19
snp_cf0073000670757 YJ4 Y CCTCGGCCCCGTCTCACTCACCGTCTTCTT GCGGCCACCATCTTCCTGCCTTAGATGCGG 2014-07-19 2014-07-19
snp_cf0016000662438 DQ8 T CCTCGGCCCCGTCTCACTCACCGTCTTCTT GCGGCCACCATCTTCCTGCCTTAGATGCGG 2014-07-19 2014-07-19
snp_cf0014000647566 DQ6 T CCTCGGCCCCGTCTCACTCACCGTCTTCTT GCGGCCACCATCTTCCTGCCTTAGATGCGG 2014-07-19 2014-07-19
snp_cf0002000431717 CID1 T CCTCGGCCCCGTCTCACTCACCGTCTTCTT GCGGCCACCATCTTCCTGCCTTAGATGCGG 2014-08-02 2014-08-02
snp_cf0033000521868 GS9 Y CCTCGGCCCCGTCTCACTCACCGTCTTCTT GCGGCCACCATCTTCCTGCCTTAGATGCGG 2014-07-19 2014-07-19
snp_cf0026000496087 GS2 Y CCTCGGCCCCGTCTCACTCACCGTCTTCTT GCGGCCACCATCTTCCTGCCTTAGATGCGG 2014-07-19 2014-07-19
snp_cf0001000300926 solidGW1 T CCTCGGCCCCGTCTCACTCACCGTCTTCTT GCGGCCACCATCTTCCTGCCTTAGATGCGG 2014-08-01 2014-08-01
snp_cf0030000527280 GS6 Y CCTCGGCCCCGTCTCACTCACCGTCTTCTT GCGGCCACCATCTTCCTGCCTTAGATGCGG 2014-07-19 2014-07-19
snp_cf0025000488809 GS1 T CCTCGGCCCCGTCTCACTCACCGTCTTCTT GCGGCCACCATCTTCCTGCCTTAGATGCGG 2014-07-19 2014-07-19
snp_cf0021000631835 FAMICHN00001 Y CCTCGGCCCCGTCTCACTCACCGTCTTCTT GCGGCCACCATCTTCCTGCCTTAGATGCGG 2014-07-19 2014-07-19
snp_cf0015000664762 DQ7 T CCTCGGCCCCGTCTCACTCACCGTCTTCTT GCGGCCACCATCTTCCTGCCTTAGATGCGG 2014-07-19 2014-07-19
snp_cf0035000633243 KM10 Y CCTCGGCCCCGTCTCACTCACCGTCTTCTT GCGGCCACCATCTTCCTGCCTTAGATGCGG 2014-07-19 2014-07-19
snp_cf0028000492192 GS4 Y CCTCGGCCCCGTCTCACTCACCGTCTTCTT GCGGCCACCATCTTCCTGCCTTAGATGCGG 2014-07-19 2014-07-19
snp_cf0010000663238 DQ2 Y CCTCGGCCCCGTCTCACTCACCGTCTTCTT GCGGCCACCATCTTCCTGCCTTAGATGCGG 2014-07-19 2014-07-19
snp_cf0020000651461 FAMBTIM00001 T CCTCGGCCCCGTCTCACTCACCGTCTTCTT GCGGCCACCATCTTCCTGCCTTAGATGCGG 2014-07-19 2014-07-19
snp_cf0041000641294 KM6 Y CCTCGGCCCCGTCTCACTCACCGTCTTCTT GCGGCCACCATCTTCCTGCCTTAGATGCGG 2014-07-19 2014-07-19
snp_cf0019000514436 FAMBGSD00001 Y CCTCGGCCCCGTCTCACTCACCGTCTTCTT GCGGCCACCATCTTCCTGCCTTAGATGCGG 2014-07-19 2014-07-19
snp_cf0058000834177 LUPWRUS00003 T CCTCGGCCCCGTCTCACTCACCGTCTTCTT GCGGCCACCATCTTCCTGCCTTAGATGCGG 2014-07-19 2014-07-19
snp_cf0007000554972 Dingo T CCTCGGCCCCGTCTCACTCACCGTCTTCTT GCGGCCACCATCTTCCTGCCTTAGATGCGG 2014-07-19 2014-07-19
snp_cf0008000657902 DQ10 Y CCTCGGCCCCGTCTCACTCACCGTCTTCTT GCGGCCACCATCTTCCTGCCTTAGATGCGG 2014-07-19 2014-07-19
snp_cf0051000663829 LJ6 T CCTCGGCCCCGTCTCACTCACCGTCTTCTT GCGGCCACCATCTTCCTGCCTTAGATGCGG 2014-07-19 2014-07-19
snp_cf0062000664267 TM3 Y CCTCGGCCCCGTCTCACTCACCGTCTTCTT GCGGCCACCATCTTCCTGCCTTAGATGCGG 2014-07-19 2014-07-19
snp_cf0043000537175 KM8 Y CCTCGGCCCCGTCTCACTCACCGTCTTCTT GCGGCCACCATCTTCCTGCCTTAGATGCGG 2014-07-19 2014-07-19
snp_cf0024000538776 GS10 T CCTCGGCCCCGTCTCACTCACCGTCTTCTT GCGGCCACCATCTTCCTGCCTTAGATGCGG 2014-07-19 2014-07-19
snp_cf0017000674961 DQ9 Y CCTCGGCCCCGTCTCACTCACCGTCTTCTT GCGGCCACCATCTTCCTGCCTTAGATGCGG 2014-07-19 2014-07-19
snp_cf0044000584403 KM9 Y CCTCGGCCCCGTCTCACTCACCGTCTTCTT GCGGCCACCATCTTCCTGCCTTAGATGCGG 2014-07-19 2014-07-19
snp_cf0059000672068 TM10 T CCTCGGCCCCGTCTCACTCACCGTCTTCTT GCGGCCACCATCTTCCTGCCTTAGATGCGG 2014-07-19 2014-07-19
snp_cf0066000676914 TM7 T CCTCGGCCCCGTCTCACTCACCGTCTTCTT GCGGCCACCATCTTCCTGCCTTAGATGCGG 2014-07-19 2014-07-19
snp_cf0060000674804 TM1 Y CCTCGGCCCCGTCTCACTCACCGTCTTCTT GCGGCCACCATCTTCCTGCCTTAGATGCGG 2014-07-19 2014-07-19
snp_cf0011000668882 DQ3 T CCTCGGCCCCGTCTCACTCACCGTCTTCTT GCGGCCACCATCTTCCTGCCTTAGATGCGG 2014-07-19 2014-07-19
snp_cf0006000768428 CRW T CCTCGGCCCCGTCTCACTCACCGTCTTCTT GCGGCCACCATCTTCCTGCCTTAGATGCGG 2014-07-19 2014-07-19
snp_cf0071000675135 YJ2 T CCTCGGCCCCGTCTCACTCACCGTCTTCTT GCGGCCACCATCTTCCTGCCTTAGATGCGG 2014-07-19 2014-07-19
snp_cf0023000621195 FAMICHN00003 T CCTCGGCCCCGTCTCACTCACCGTCTTCTT GCGGCCACCATCTTCCTGCCTTAGATGCGG 2014-07-19 2014-07-19
snp_cf0068000629341 TM9 T CCTCGGCCCCGTCTCACTCACCGTCTTCTT GCGGCCACCATCTTCCTGCCTTAGATGCGG 2014-07-19 2014-07-19
6.Fasta Information
CCACGTGAAT CGGCTTCCGG CCTCGGCCCC GTCTCACTCA CCGTCTTCTT
Y
GCGGCCACCA TCTTCCTGCC TTAGATGCGG GACGGCCCCA ACCTAGAACG