e.g. 1:1246..9423
SNP Detail For snp_cf0018000552350    [See in GBrowse]
1.General Information
SNP ID: snp_cf0018000552350
Organism: Canis familiaris
Individual: FAMBBEM00001
Create time: 2014-07-19
Last update: 2014-07-19
2.Allele Information
Platform: SOLEXA
Method: sequence
SNP Class: snp
Genotype: A
5'flank: GAAGAGAAGTGAATTGCTGGTGCCCGGGTC
3'flank: CAGCTTGTTTTAGGGCCCCAGGAATCCAAG
3.Reference Map information
Chrom Position Reference FAMBBEM00001
Chr13 387253 G A
4.Gene information
Gene model(s)
Gene ID Position in Gene Strands Gene Allele Location
ENSCAFG00000000469 22200 + G CDS
Transcript Protein
SNP to transcript Accession Position in Transcript Allele change Accession Position in Protein Residue change
+ ENSCAFT00000046336 1749 TCG => TCA ENSCAFP00000039863 583 S => S
+ ENSCAFT00000000751 1773 TCG => TCA ENSCAFP00000000694 591 S => S
5.SNPs of other individuals in this position
SNP_ID Individual Genotype 5' Near Seq 30 bp 3' Near Seq 30 bp Create time Last update time
snp_cf0062000664313 TM3 A GAAGAGAAGTGAATTGCTGGTGCCCGGGTC CAGCTTGTTTTAGGGCCCCAGGAATCCAAG 2014-07-19 2014-07-19
snp_cf0077000675967 YJ8 A GAAGAGAAGTGAATTGCTGGTGCCCGGGTC CAGCTTGTTTTAGGGCCCCAGGAATCCAAG 2014-07-19 2014-07-19
snp_cf0008000657954 DQ10 A GAAGAGAAGTGAATTGCTGGTGCCCGGGTC CAGCTTGTTTTAGGGCCCCAGGAATCCAAG 2014-07-19 2014-07-19
snp_cf0026000496143 GS2 A GAAGAGAAGTGAATTGCTGGTGCCCGGGTC CAGCTTGTTTTAGGGCCCCAGGAATCCAAG 2014-07-19 2014-07-19
snp_cf0058000834221 LUPWRUS00003 A GAAGAGAAGTGAATTGCTGGTGCCCGGGTC CAGCTTGTTTTAGGGCCCCAGGAATCCAAG 2014-07-19 2014-07-19
snp_cf0032000502073 GS8 A GAAGAGAAGTGAATTGCTGGTGCCCGGGTC CAGCTTGTTTTAGGGCCCCAGGAATCCAAG 2014-07-19 2014-07-19
snp_cf0048000630878 LJ3 A GAAGAGAAGTGAATTGCTGGTGCCCGGGTC CAGCTTGTTTTAGGGCCCCAGGAATCCAAG 2014-07-19 2014-07-19
snp_cf0065000644226 TM6 A GAAGAGAAGTGAATTGCTGGTGCCCGGGTC CAGCTTGTTTTAGGGCCCCAGGAATCCAAG 2014-07-19 2014-07-19
snp_cf0017000675019 DQ9 A GAAGAGAAGTGAATTGCTGGTGCCCGGGTC CAGCTTGTTTTAGGGCCCCAGGAATCCAAG 2014-07-19 2014-07-19
snp_cf0069000684616 YJ10 A GAAGAGAAGTGAATTGCTGGTGCCCGGGTC CAGCTTGTTTTAGGGCCCCAGGAATCCAAG 2014-07-19 2014-07-19
snp_cf0014000647632 DQ6 A GAAGAGAAGTGAATTGCTGGTGCCCGGGTC CAGCTTGTTTTAGGGCCCCAGGAATCCAAG 2014-07-19 2014-07-19
snp_cf0045000592234 LJ10 A GAAGAGAAGTGAATTGCTGGTGCCCGGGTC CAGCTTGTTTTAGGGCCCCAGGAATCCAAG 2014-07-19 2014-07-19
snp_cf0030000527338 GS6 A GAAGAGAAGTGAATTGCTGGTGCCCGGGTC CAGCTTGTTTTAGGGCCCCAGGAATCCAAG 2014-07-19 2014-07-19
snp_cf0067000641378 TM8 A GAAGAGAAGTGAATTGCTGGTGCCCGGGTC CAGCTTGTTTTAGGGCCCCAGGAATCCAAG 2014-07-19 2014-07-19
snp_cf0006000768472 CRW A GAAGAGAAGTGAATTGCTGGTGCCCGGGTC CAGCTTGTTTTAGGGCCCCAGGAATCCAAG 2014-07-19 2014-07-19
snp_cf0057000816619 LUPWRUS00002 A GAAGAGAAGTGAATTGCTGGTGCCCGGGTC CAGCTTGTTTTAGGGCCCCAGGAATCCAAG 2014-07-19 2014-07-19
snp_cf0002000431748 CID1 A GAAGAGAAGTGAATTGCTGGTGCCCGGGTC CAGCTTGTTTTAGGGCCCCAGGAATCCAAG 2014-08-02 2014-08-02
snp_cf0023000621240 FAMICHN00003 A GAAGAGAAGTGAATTGCTGGTGCCCGGGTC CAGCTTGTTTTAGGGCCCCAGGAATCCAAG 2014-07-19 2014-07-19
snp_cf0038000542452 KM3 A GAAGAGAAGTGAATTGCTGGTGCCCGGGTC CAGCTTGTTTTAGGGCCCCAGGAATCCAAG 2014-07-19 2014-07-19
snp_cf0041000641355 KM6 A GAAGAGAAGTGAATTGCTGGTGCCCGGGTC CAGCTTGTTTTAGGGCCCCAGGAATCCAAG 2014-07-19 2014-07-19
snp_cf0004000554372 Basenji A GAAGAGAAGTGAATTGCTGGTGCCCGGGTC CAGCTTGTTTTAGGGCCCCAGGAATCCAAG 2014-07-19 2014-07-19
snp_cf0055000832395 LUPWCHN00001 A GAAGAGAAGTGAATTGCTGGTGCCCGGGTC CAGCTTGTTTTAGGGCCCCAGGAATCCAAG 2014-07-19 2014-07-19
snp_cf0061000675403 TM2 A GAAGAGAAGTGAATTGCTGGTGCCCGGGTC CAGCTTGTTTTAGGGCCCCAGGAATCCAAG 2014-07-19 2014-07-19
snp_cf0049000663825 LJ4 A GAAGAGAAGTGAATTGCTGGTGCCCGGGTC CAGCTTGTTTTAGGGCCCCAGGAATCCAAG 2014-07-19 2014-07-19
snp_cf0070000697437 YJ1 A GAAGAGAAGTGAATTGCTGGTGCCCGGGTC CAGCTTGTTTTAGGGCCCCAGGAATCCAAG 2014-07-19 2014-07-19
snp_cf0016000662486 DQ8 A GAAGAGAAGTGAATTGCTGGTGCCCGGGTC CAGCTTGTTTTAGGGCCCCAGGAATCCAAG 2014-07-19 2014-07-19
snp_cf0037000531325 KM2 A GAAGAGAAGTGAATTGCTGGTGCCCGGGTC CAGCTTGTTTTAGGGCCCCAGGAATCCAAG 2014-07-19 2014-07-19
snp_cf0011000668930 DQ3 A GAAGAGAAGTGAATTGCTGGTGCCCGGGTC CAGCTTGTTTTAGGGCCCCAGGAATCCAAG 2014-07-19 2014-07-19
snp_cf0013000633044 DQ5 A GAAGAGAAGTGAATTGCTGGTGCCCGGGTC CAGCTTGTTTTAGGGCCCCAGGAATCCAAG 2014-07-19 2014-07-19
snp_cf0027000515628 GS3 A GAAGAGAAGTGAATTGCTGGTGCCCGGGTC CAGCTTGTTTTAGGGCCCCAGGAATCCAAG 2014-07-19 2014-07-19
snp_cf0063000654216 TM4 A GAAGAGAAGTGAATTGCTGGTGCCCGGGTC CAGCTTGTTTTAGGGCCCCAGGAATCCAAG 2014-07-19 2014-07-19
snp_cf0035000633303 KM10 A GAAGAGAAGTGAATTGCTGGTGCCCGGGTC CAGCTTGTTTTAGGGCCCCAGGAATCCAAG 2014-07-19 2014-07-19
snp_cf0054000590360 LJ9 A GAAGAGAAGTGAATTGCTGGTGCCCGGGTC CAGCTTGTTTTAGGGCCCCAGGAATCCAAG 2014-07-19 2014-07-19
snp_cf0074000671690 YJ5 A GAAGAGAAGTGAATTGCTGGTGCCCGGGTC CAGCTTGTTTTAGGGCCCCAGGAATCCAAG 2014-07-19 2014-07-19
snp_cf0029000460797 GS5 A GAAGAGAAGTGAATTGCTGGTGCCCGGGTC CAGCTTGTTTTAGGGCCCCAGGAATCCAAG 2014-07-19 2014-07-19
snp_cf0059000672124 TM10 A GAAGAGAAGTGAATTGCTGGTGCCCGGGTC CAGCTTGTTTTAGGGCCCCAGGAATCCAAG 2014-07-19 2014-07-19
snp_cf0043000537234 KM8 A GAAGAGAAGTGAATTGCTGGTGCCCGGGTC CAGCTTGTTTTAGGGCCCCAGGAATCCAAG 2014-07-19 2014-07-19
snp_cf0012000662204 DQ4 A GAAGAGAAGTGAATTGCTGGTGCCCGGGTC CAGCTTGTTTTAGGGCCCCAGGAATCCAAG 2014-07-19 2014-07-19
snp_cf0019000514491 FAMBGSD00001 A GAAGAGAAGTGAATTGCTGGTGCCCGGGTC CAGCTTGTTTTAGGGCCCCAGGAATCCAAG 2014-07-19 2014-07-19
snp_cf0040000580594 KM5 A GAAGAGAAGTGAATTGCTGGTGCCCGGGTC CAGCTTGTTTTAGGGCCCCAGGAATCCAAG 2014-07-19 2014-07-19
snp_cf0034000783017 ISW A GAAGAGAAGTGAATTGCTGGTGCCCGGGTC CAGCTTGTTTTAGGGCCCCAGGAATCCAAG 2014-07-19 2014-07-19
snp_cf0044000584462 KM9 A GAAGAGAAGTGAATTGCTGGTGCCCGGGTC CAGCTTGTTTTAGGGCCCCAGGAATCCAAG 2014-07-19 2014-07-19
snp_cf0007000555015 Dingo A GAAGAGAAGTGAATTGCTGGTGCCCGGGTC CAGCTTGTTTTAGGGCCCCAGGAATCCAAG 2014-07-19 2014-07-19
snp_cf0052000642254 LJ7 A GAAGAGAAGTGAATTGCTGGTGCCCGGGTC CAGCTTGTTTTAGGGCCCCAGGAATCCAAG 2014-07-19 2014-07-19
snp_cf0010000663280 DQ2 A GAAGAGAAGTGAATTGCTGGTGCCCGGGTC CAGCTTGTTTTAGGGCCCCAGGAATCCAAG 2014-07-19 2014-07-19
snp_cf0039000509411 KM4 A GAAGAGAAGTGAATTGCTGGTGCCCGGGTC CAGCTTGTTTTAGGGCCCCAGGAATCCAAG 2014-07-19 2014-07-19
snp_cf0076000680321 YJ7 A GAAGAGAAGTGAATTGCTGGTGCCCGGGTC CAGCTTGTTTTAGGGCCCCAGGAATCCAAG 2014-07-19 2014-07-19
snp_cf0036000515978 KM1 A GAAGAGAAGTGAATTGCTGGTGCCCGGGTC CAGCTTGTTTTAGGGCCCCAGGAATCCAAG 2014-07-19 2014-07-19
snp_cf0068000629409 TM9 A GAAGAGAAGTGAATTGCTGGTGCCCGGGTC CAGCTTGTTTTAGGGCCCCAGGAATCCAAG 2014-07-19 2014-07-19
snp_cf0001000300963 solidGW1 A GAAGAGAAGTGAATTGCTGGTGCCCGGGTC CAGCTTGTTTTAGGGCCCCAGGAATCCAAG 2014-08-01 2014-08-01
snp_cf0005000813608 CHW A GAAGAGAAGTGAATTGCTGGTGCCCGGGTC CAGCTTGTTTTAGGGCCCCAGGAATCCAAG 2014-07-19 2014-07-19
snp_cf0015000664830 DQ7 A GAAGAGAAGTGAATTGCTGGTGCCCGGGTC CAGCTTGTTTTAGGGCCCCAGGAATCCAAG 2014-07-19 2014-07-19
snp_cf0024000538815 GS10 A GAAGAGAAGTGAATTGCTGGTGCCCGGGTC CAGCTTGTTTTAGGGCCCCAGGAATCCAAG 2014-07-19 2014-07-19
snp_cf0025000488848 GS1 A GAAGAGAAGTGAATTGCTGGTGCCCGGGTC CAGCTTGTTTTAGGGCCCCAGGAATCCAAG 2014-07-19 2014-07-19
snp_cf0053000645376 LJ8 A GAAGAGAAGTGAATTGCTGGTGCCCGGGTC CAGCTTGTTTTAGGGCCCCAGGAATCCAAG 2014-07-19 2014-07-19
snp_cf0073000670807 YJ4 A GAAGAGAAGTGAATTGCTGGTGCCCGGGTC CAGCTTGTTTTAGGGCCCCAGGAATCCAAG 2014-07-19 2014-07-19
snp_cf0056000840972 LUPWRUS00001 A GAAGAGAAGTGAATTGCTGGTGCCCGGGTC CAGCTTGTTTTAGGGCCCCAGGAATCCAAG 2014-07-19 2014-07-19
snp_cf0009000664126 DQ1 A GAAGAGAAGTGAATTGCTGGTGCCCGGGTC CAGCTTGTTTTAGGGCCCCAGGAATCCAAG 2014-07-19 2014-07-19
snp_cf0020000651506 FAMBTIM00001 A GAAGAGAAGTGAATTGCTGGTGCCCGGGTC CAGCTTGTTTTAGGGCCCCAGGAATCCAAG 2014-07-19 2014-07-19
snp_cf0022000588403 FAMICHN00002 A GAAGAGAAGTGAATTGCTGGTGCCCGGGTC CAGCTTGTTTTAGGGCCCCAGGAATCCAAG 2014-07-19 2014-07-19
snp_cf0066000676963 TM7 A GAAGAGAAGTGAATTGCTGGTGCCCGGGTC CAGCTTGTTTTAGGGCCCCAGGAATCCAAG 2014-07-19 2014-07-19
snp_cf0031000526119 GS7 A GAAGAGAAGTGAATTGCTGGTGCCCGGGTC CAGCTTGTTTTAGGGCCCCAGGAATCCAAG 2014-07-19 2014-07-19
snp_cf0021000631880 FAMICHN00001 A GAAGAGAAGTGAATTGCTGGTGCCCGGGTC CAGCTTGTTTTAGGGCCCCAGGAATCCAAG 2014-07-19 2014-07-19
snp_cf0047000631505 LJ2 A GAAGAGAAGTGAATTGCTGGTGCCCGGGTC CAGCTTGTTTTAGGGCCCCAGGAATCCAAG 2014-07-19 2014-07-19
snp_cf0064000671604 TM5 A GAAGAGAAGTGAATTGCTGGTGCCCGGGTC CAGCTTGTTTTAGGGCCCCAGGAATCCAAG 2014-07-19 2014-07-19
snp_cf0072000683194 YJ3 A GAAGAGAAGTGAATTGCTGGTGCCCGGGTC CAGCTTGTTTTAGGGCCCCAGGAATCCAAG 2014-07-19 2014-07-19
snp_cf0071000675181 YJ2 A GAAGAGAAGTGAATTGCTGGTGCCCGGGTC CAGCTTGTTTTAGGGCCCCAGGAATCCAAG 2014-07-19 2014-07-19
snp_cf0028000492253 GS4 A GAAGAGAAGTGAATTGCTGGTGCCCGGGTC CAGCTTGTTTTAGGGCCCCAGGAATCCAAG 2014-07-19 2014-07-19
snp_cf0078000676954 YJ9 A GAAGAGAAGTGAATTGCTGGTGCCCGGGTC CAGCTTGTTTTAGGGCCCCAGGAATCCAAG 2014-07-19 2014-07-19
snp_cf0046000600198 LJ1 A GAAGAGAAGTGAATTGCTGGTGCCCGGGTC CAGCTTGTTTTAGGGCCCCAGGAATCCAAG 2014-07-19 2014-07-19
snp_cf0060000674849 TM1 A GAAGAGAAGTGAATTGCTGGTGCCCGGGTC CAGCTTGTTTTAGGGCCCCAGGAATCCAAG 2014-07-19 2014-07-19
snp_cf0051000663867 LJ6 A GAAGAGAAGTGAATTGCTGGTGCCCGGGTC CAGCTTGTTTTAGGGCCCCAGGAATCCAAG 2014-07-19 2014-07-19
snp_cf0033000521928 GS9 A GAAGAGAAGTGAATTGCTGGTGCCCGGGTC CAGCTTGTTTTAGGGCCCCAGGAATCCAAG 2014-07-19 2014-07-19
snp_cf0075000684194 YJ6 A GAAGAGAAGTGAATTGCTGGTGCCCGGGTC CAGCTTGTTTTAGGGCCCCAGGAATCCAAG 2014-07-19 2014-07-19
snp_cf0050000605867 LJ5 A GAAGAGAAGTGAATTGCTGGTGCCCGGGTC CAGCTTGTTTTAGGGCCCCAGGAATCCAAG 2014-07-19 2014-07-19
snp_cf0042000664176 KM7 A GAAGAGAAGTGAATTGCTGGTGCCCGGGTC CAGCTTGTTTTAGGGCCCCAGGAATCCAAG 2014-07-19 2014-07-19
6.Fasta Information
CCACTCTAGG ATTTAAACCG GAAGAGAAGT GAATTGCTGG TGCCCGGGTC
A
CAGCTTGTTT TAGGGCCCCA GGAATCCAAG ATACCTATAC TTTTGATTCA