e.g. 1:1246..9423
SNP Detail For snp_cf0018000764684    [See in GBrowse]
1.General Information
SNP ID: snp_cf0018000764684
Organism: Canis familiaris
Individual: FAMBBEM00001
Create time: 2014-07-19
Last update: 2014-07-19
2.Allele Information
Platform: SOLEXA
Method: sequence
SNP Class: snp
Genotype: C
5'flank: GAGAAGGCTTTGATCTGTCCCTGGGCTGAG
3'flank: GGATCTTCATGATGGTGGCAAAGATGTTGG
3.Reference Map information
Chrom Position Reference FAMBBEM00001
Chr15 236165 T C
4.Gene information
Gene model(s)
Gene ID Position in Gene Strands Gene Allele Location
ENSCAFG00000002484 686 - T CDS
Transcript Protein
SNP to transcript Accession Position in Transcript Allele change Accession Position in Protein Residue change
- ENSCAFT00000026823 686 CAC => CGC ENSCAFP00000024926 229 H => R
5.SNPs of other individuals in this position
SNP_ID Individual Genotype 5' Near Seq 30 bp 3' Near Seq 30 bp Create time Last update time
snp_cf0025000710411 GS1 C GAGAAGGCTTTGATCTGTCCCTGGGCTGAG GGATCTTCATGATGGTGGCAAAGATGTTGG 2014-07-19 2014-07-19
snp_cf0038000725085 KM3 C GAGAAGGCTTTGATCTGTCCCTGGGCTGAG GGATCTTCATGATGGTGGCAAAGATGTTGG 2014-07-19 2014-07-19
snp_cf0034001081611 ISW C GAGAAGGCTTTGATCTGTCCCTGGGCTGAG GGATCTTCATGATGGTGGCAAAGATGTTGG 2014-07-19 2014-07-19
snp_cf0002000599589 CID1 C GAGAAGGCTTTGATCTGTCCCTGGGCTGAG GGATCTTCATGATGGTGGCAAAGATGTTGG 2014-08-02 2014-08-02
snp_cf0053000895510 LJ8 C GAGAAGGCTTTGATCTGTCCCTGGGCTGAG GGATCTTCATGATGGTGGCAAAGATGTTGG 2014-07-19 2014-07-19
snp_cf0063000903155 TM4 Y GAGAAGGCTTTGATCTGTCCCTGGGCTGAG GGATCTTCATGATGGTGGCAAAGATGTTGG 2014-07-19 2014-07-19
snp_cf0036000740251 KM1 C GAGAAGGCTTTGATCTGTCCCTGGGCTGAG GGATCTTCATGATGGTGGCAAAGATGTTGG 2014-07-19 2014-07-19
snp_cf0042000933375 KM7 Y GAGAAGGCTTTGATCTGTCCCTGGGCTGAG GGATCTTCATGATGGTGGCAAAGATGTTGG 2014-07-19 2014-07-19
snp_cf0004000758289 Basenji C GAGAAGGCTTTGATCTGTCCCTGGGCTGAG GGATCTTCATGATGGTGGCAAAGATGTTGG 2014-07-19 2014-07-19
snp_cf0074000934998 YJ5 Y GAGAAGGCTTTGATCTGTCCCTGGGCTGAG GGATCTTCATGATGGTGGCAAAGATGTTGG 2014-07-19 2014-07-19
snp_cf0045000826310 LJ10 C GAGAAGGCTTTGATCTGTCCCTGGGCTGAG GGATCTTCATGATGGTGGCAAAGATGTTGG 2014-07-19 2014-07-19
snp_cf0046000849275 LJ1 Y GAGAAGGCTTTGATCTGTCCCTGGGCTGAG GGATCTTCATGATGGTGGCAAAGATGTTGG 2014-07-19 2014-07-19
snp_cf0056001167516 LUPWRUS00001 C GAGAAGGCTTTGATCTGTCCCTGGGCTGAG GGATCTTCATGATGGTGGCAAAGATGTTGG 2014-07-19 2014-07-19
snp_cf0058001147139 LUPWRUS00003 C GAGAAGGCTTTGATCTGTCCCTGGGCTGAG GGATCTTCATGATGGTGGCAAAGATGTTGG 2014-07-19 2014-07-19
snp_cf0069000950431 YJ10 C GAGAAGGCTTTGATCTGTCCCTGGGCTGAG GGATCTTCATGATGGTGGCAAAGATGTTGG 2014-07-19 2014-07-19
snp_cf0032000709589 GS8 C GAGAAGGCTTTGATCTGTCCCTGGGCTGAG GGATCTTCATGATGGTGGCAAAGATGTTGG 2014-07-19 2014-07-19
snp_cf0062000922602 TM3 C GAGAAGGCTTTGATCTGTCCCTGGGCTGAG GGATCTTCATGATGGTGGCAAAGATGTTGG 2014-07-19 2014-07-19
snp_cf0078000938386 YJ9 Y GAGAAGGCTTTGATCTGTCCCTGGGCTGAG GGATCTTCATGATGGTGGCAAAGATGTTGG 2014-07-19 2014-07-19
snp_cf0050000851365 LJ5 Y GAGAAGGCTTTGATCTGTCCCTGGGCTGAG GGATCTTCATGATGGTGGCAAAGATGTTGG 2014-07-19 2014-07-19
snp_cf0021000878948 FAMICHN00001 C GAGAAGGCTTTGATCTGTCCCTGGGCTGAG GGATCTTCATGATGGTGGCAAAGATGTTGG 2014-07-19 2014-07-19
snp_cf0022000816174 FAMICHN00002 C GAGAAGGCTTTGATCTGTCCCTGGGCTGAG GGATCTTCATGATGGTGGCAAAGATGTTGG 2014-07-19 2014-07-19
snp_cf0052000896817 LJ7 C GAGAAGGCTTTGATCTGTCCCTGGGCTGAG GGATCTTCATGATGGTGGCAAAGATGTTGG 2014-07-19 2014-07-19
snp_cf0076000945369 YJ7 Y GAGAAGGCTTTGATCTGTCCCTGGGCTGAG GGATCTTCATGATGGTGGCAAAGATGTTGG 2014-07-19 2014-07-19
snp_cf0023000871056 FAMICHN00003 Y GAGAAGGCTTTGATCTGTCCCTGGGCTGAG GGATCTTCATGATGGTGGCAAAGATGTTGG 2014-07-19 2014-07-19
snp_cf0035000894482 KM10 C GAGAAGGCTTTGATCTGTCCCTGGGCTGAG GGATCTTCATGATGGTGGCAAAGATGTTGG 2014-07-19 2014-07-19
snp_cf0027000719065 GS3 C GAGAAGGCTTTGATCTGTCCCTGGGCTGAG GGATCTTCATGATGGTGGCAAAGATGTTGG 2014-07-19 2014-07-19
snp_cf0033000720767 GS9 C GAGAAGGCTTTGATCTGTCCCTGGGCTGAG GGATCTTCATGATGGTGGCAAAGATGTTGG 2014-07-19 2014-07-19
snp_cf0017000935052 DQ9 C GAGAAGGCTTTGATCTGTCCCTGGGCTGAG GGATCTTCATGATGGTGGCAAAGATGTTGG 2014-07-19 2014-07-19
snp_cf0007000775857 Dingo Y GAGAAGGCTTTGATCTGTCCCTGGGCTGAG GGATCTTCATGATGGTGGCAAAGATGTTGG 2014-07-19 2014-07-19
snp_cf0008000905993 DQ10 Y GAGAAGGCTTTGATCTGTCCCTGGGCTGAG GGATCTTCATGATGGTGGCAAAGATGTTGG 2014-07-19 2014-07-19
snp_cf0020000911354 FAMBTIM00001 C GAGAAGGCTTTGATCTGTCCCTGGGCTGAG GGATCTTCATGATGGTGGCAAAGATGTTGG 2014-07-19 2014-07-19
snp_cf0068000881200 TM9 C GAGAAGGCTTTGATCTGTCCCTGGGCTGAG GGATCTTCATGATGGTGGCAAAGATGTTGG 2014-07-19 2014-07-19
snp_cf0077000937257 YJ8 C GAGAAGGCTTTGATCTGTCCCTGGGCTGAG GGATCTTCATGATGGTGGCAAAGATGTTGG 2014-07-19 2014-07-19
snp_cf0029000662960 GS5 C GAGAAGGCTTTGATCTGTCCCTGGGCTGAG GGATCTTCATGATGGTGGCAAAGATGTTGG 2014-07-19 2014-07-19
snp_cf0011000927505 DQ3 Y GAGAAGGCTTTGATCTGTCCCTGGGCTGAG GGATCTTCATGATGGTGGCAAAGATGTTGG 2014-07-19 2014-07-19
snp_cf0070000967527 YJ1 Y GAGAAGGCTTTGATCTGTCCCTGGGCTGAG GGATCTTCATGATGGTGGCAAAGATGTTGG 2014-07-19 2014-07-19
snp_cf0061000932187 TM2 C GAGAAGGCTTTGATCTGTCCCTGGGCTGAG GGATCTTCATGATGGTGGCAAAGATGTTGG 2014-07-19 2014-07-19
snp_cf0040000820757 KM5 C GAGAAGGCTTTGATCTGTCCCTGGGCTGAG GGATCTTCATGATGGTGGCAAAGATGTTGG 2014-07-19 2014-07-19
snp_cf0048000876906 LJ3 Y GAGAAGGCTTTGATCTGTCCCTGGGCTGAG GGATCTTCATGATGGTGGCAAAGATGTTGG 2014-07-19 2014-07-19
snp_cf0044000817836 KM9 Y GAGAAGGCTTTGATCTGTCCCTGGGCTGAG GGATCTTCATGATGGTGGCAAAGATGTTGG 2014-07-19 2014-07-19
snp_cf0067000883886 TM8 C GAGAAGGCTTTGATCTGTCCCTGGGCTGAG GGATCTTCATGATGGTGGCAAAGATGTTGG 2014-07-19 2014-07-19
snp_cf0051000920740 LJ6 Y GAGAAGGCTTTGATCTGTCCCTGGGCTGAG GGATCTTCATGATGGTGGCAAAGATGTTGG 2014-07-19 2014-07-19
snp_cf0015000919976 DQ7 C GAGAAGGCTTTGATCTGTCCCTGGGCTGAG GGATCTTCATGATGGTGGCAAAGATGTTGG 2014-07-19 2014-07-19
snp_cf0060000924588 TM1 C GAGAAGGCTTTGATCTGTCCCTGGGCTGAG GGATCTTCATGATGGTGGCAAAGATGTTGG 2014-07-19 2014-07-19
snp_cf0041000901653 KM6 Y GAGAAGGCTTTGATCTGTCCCTGGGCTGAG GGATCTTCATGATGGTGGCAAAGATGTTGG 2014-07-19 2014-07-19
snp_cf0071000939901 YJ2 Y GAGAAGGCTTTGATCTGTCCCTGGGCTGAG GGATCTTCATGATGGTGGCAAAGATGTTGG 2014-07-19 2014-07-19
snp_cf0005001130465 CHW C GAGAAGGCTTTGATCTGTCCCTGGGCTGAG GGATCTTCATGATGGTGGCAAAGATGTTGG 2014-07-19 2014-07-19
snp_cf0014000907321 DQ6 Y GAGAAGGCTTTGATCTGTCCCTGGGCTGAG GGATCTTCATGATGGTGGCAAAGATGTTGG 2014-07-19 2014-07-19
snp_cf0016000916882 DQ8 Y GAGAAGGCTTTGATCTGTCCCTGGGCTGAG GGATCTTCATGATGGTGGCAAAGATGTTGG 2014-07-19 2014-07-19
snp_cf0009000923766 DQ1 C GAGAAGGCTTTGATCTGTCCCTGGGCTGAG GGATCTTCATGATGGTGGCAAAGATGTTGG 2014-07-19 2014-07-19
snp_cf0072000941433 YJ3 C GAGAAGGCTTTGATCTGTCCCTGGGCTGAG GGATCTTCATGATGGTGGCAAAGATGTTGG 2014-07-19 2014-07-19
snp_cf0057001112711 LUPWRUS00002 C GAGAAGGCTTTGATCTGTCCCTGGGCTGAG GGATCTTCATGATGGTGGCAAAGATGTTGG 2014-07-19 2014-07-19
snp_cf0024000748195 GS10 C GAGAAGGCTTTGATCTGTCCCTGGGCTGAG GGATCTTCATGATGGTGGCAAAGATGTTGG 2014-07-19 2014-07-19
snp_cf0012000922727 DQ4 Y GAGAAGGCTTTGATCTGTCCCTGGGCTGAG GGATCTTCATGATGGTGGCAAAGATGTTGG 2014-07-19 2014-07-19
snp_cf0019000720255 FAMBGSD00001 C GAGAAGGCTTTGATCTGTCCCTGGGCTGAG GGATCTTCATGATGGTGGCAAAGATGTTGG 2014-07-19 2014-07-19
snp_cf0030000740038 GS6 C GAGAAGGCTTTGATCTGTCCCTGGGCTGAG GGATCTTCATGATGGTGGCAAAGATGTTGG 2014-07-19 2014-07-19
snp_cf0028000686970 GS4 C GAGAAGGCTTTGATCTGTCCCTGGGCTGAG GGATCTTCATGATGGTGGCAAAGATGTTGG 2014-07-19 2014-07-19
snp_cf0043000762136 KM8 C GAGAAGGCTTTGATCTGTCCCTGGGCTGAG GGATCTTCATGATGGTGGCAAAGATGTTGG 2014-07-19 2014-07-19
snp_cf0006001063783 CRW C GAGAAGGCTTTGATCTGTCCCTGGGCTGAG GGATCTTCATGATGGTGGCAAAGATGTTGG 2014-07-19 2014-07-19
snp_cf0039000730423 KM4 C GAGAAGGCTTTGATCTGTCCCTGGGCTGAG GGATCTTCATGATGGTGGCAAAGATGTTGG 2014-07-19 2014-07-19
snp_cf0001000388280 solidGW1 C GAGAAGGCTTTGATCTGTCCCTGGGCTGAG GGATCTTCATGATGGTGGCAAAGATGTTGG 2014-08-01 2014-08-01
snp_cf0066000937701 TM7 C GAGAAGGCTTTGATCTGTCCCTGGGCTGAG GGATCTTCATGATGGTGGCAAAGATGTTGG 2014-07-19 2014-07-19
snp_cf0031000737914 GS7 C GAGAAGGCTTTGATCTGTCCCTGGGCTGAG GGATCTTCATGATGGTGGCAAAGATGTTGG 2014-07-19 2014-07-19
snp_cf0026000711470 GS2 C GAGAAGGCTTTGATCTGTCCCTGGGCTGAG GGATCTTCATGATGGTGGCAAAGATGTTGG 2014-07-19 2014-07-19
snp_cf0059000929488 TM10 C GAGAAGGCTTTGATCTGTCCCTGGGCTGAG GGATCTTCATGATGGTGGCAAAGATGTTGG 2014-07-19 2014-07-19
snp_cf0064000928025 TM5 C GAGAAGGCTTTGATCTGTCCCTGGGCTGAG GGATCTTCATGATGGTGGCAAAGATGTTGG 2014-07-19 2014-07-19
snp_cf0055001152524 LUPWCHN00001 C GAGAAGGCTTTGATCTGTCCCTGGGCTGAG GGATCTTCATGATGGTGGCAAAGATGTTGG 2014-07-19 2014-07-19
6.Fasta Information
TGATGTGGGA GGCACAGGTG GAGAAGGCTT TGATCTGTCC CTGGGCTGAG
C
GGATCTTCAT GATGGTGGCA AAGATGTTGG CATAGACAAT GACAACCAGG