e.g. 1:1246..9423
SNP Detail For snp_cf0018000764685    [See in GBrowse]
1.General Information
SNP ID: snp_cf0018000764685
Organism: Canis familiaris
Individual: FAMBBEM00001
Create time: 2014-07-19
Last update: 2014-07-19
2.Allele Information
Platform: SOLEXA
Method: sequence
SNP Class: snp
Genotype: C
5'flank: GGGATGTGTCTGCACAGGCCAGCTTCAGGA
3'flank: GGCAGGGACCTCACAGAAGTAGTGGTCAAT
3.Reference Map information
Chrom Position Reference FAMBBEM00001
Chr15 236301 T C
4.Gene information
Gene model(s)
Gene ID Position in Gene Strands Gene Allele Location
ENSCAFG00000002484 550 - T CDS
Transcript Protein
SNP to transcript Accession Position in Transcript Allele change Accession Position in Protein Residue change
- ENSCAFT00000026823 550 ATC => GTC ENSCAFP00000024926 184 I => V
5.SNPs of other individuals in this position
SNP_ID Individual Genotype 5' Near Seq 30 bp 3' Near Seq 30 bp Create time Last update time
snp_cf0025000710412 GS1 C GGGATGTGTCTGCACAGGCCAGCTTCAGGA GGCAGGGACCTCACAGAAGTAGTGGTCAAT 2014-07-19 2014-07-19
snp_cf0038000725086 KM3 C GGGATGTGTCTGCACAGGCCAGCTTCAGGA GGCAGGGACCTCACAGAAGTAGTGGTCAAT 2014-07-19 2014-07-19
snp_cf0053000895511 LJ8 C GGGATGTGTCTGCACAGGCCAGCTTCAGGA GGCAGGGACCTCACAGAAGTAGTGGTCAAT 2014-07-19 2014-07-19
snp_cf0036000740252 KM1 C GGGATGTGTCTGCACAGGCCAGCTTCAGGA GGCAGGGACCTCACAGAAGTAGTGGTCAAT 2014-07-19 2014-07-19
snp_cf0042000933377 KM7 Y GGGATGTGTCTGCACAGGCCAGCTTCAGGA GGCAGGGACCTCACAGAAGTAGTGGTCAAT 2014-07-19 2014-07-19
snp_cf0032000709590 GS8 C GGGATGTGTCTGCACAGGCCAGCTTCAGGA GGCAGGGACCTCACAGAAGTAGTGGTCAAT 2014-07-19 2014-07-19
snp_cf0074000934999 YJ5 Y GGGATGTGTCTGCACAGGCCAGCTTCAGGA GGCAGGGACCTCACAGAAGTAGTGGTCAAT 2014-07-19 2014-07-19
snp_cf0045000826311 LJ10 C GGGATGTGTCTGCACAGGCCAGCTTCAGGA GGCAGGGACCTCACAGAAGTAGTGGTCAAT 2014-07-19 2014-07-19
snp_cf0002000599590 CID1 C GGGATGTGTCTGCACAGGCCAGCTTCAGGA GGCAGGGACCTCACAGAAGTAGTGGTCAAT 2014-08-02 2014-08-02
snp_cf0046000849276 LJ1 Y GGGATGTGTCTGCACAGGCCAGCTTCAGGA GGCAGGGACCTCACAGAAGTAGTGGTCAAT 2014-07-19 2014-07-19
snp_cf0076000945370 YJ7 Y GGGATGTGTCTGCACAGGCCAGCTTCAGGA GGCAGGGACCTCACAGAAGTAGTGGTCAAT 2014-07-19 2014-07-19
snp_cf0056001167517 LUPWRUS00001 Y GGGATGTGTCTGCACAGGCCAGCTTCAGGA GGCAGGGACCTCACAGAAGTAGTGGTCAAT 2014-07-19 2014-07-19
snp_cf0017000935053 DQ9 C GGGATGTGTCTGCACAGGCCAGCTTCAGGA GGCAGGGACCTCACAGAAGTAGTGGTCAAT 2014-07-19 2014-07-19
snp_cf0069000950432 YJ10 Y GGGATGTGTCTGCACAGGCCAGCTTCAGGA GGCAGGGACCTCACAGAAGTAGTGGTCAAT 2014-07-19 2014-07-19
snp_cf0052000896818 LJ7 C GGGATGTGTCTGCACAGGCCAGCTTCAGGA GGCAGGGACCTCACAGAAGTAGTGGTCAAT 2014-07-19 2014-07-19
snp_cf0062000922603 TM3 Y GGGATGTGTCTGCACAGGCCAGCTTCAGGA GGCAGGGACCTCACAGAAGTAGTGGTCAAT 2014-07-19 2014-07-19
snp_cf0050000851366 LJ5 Y GGGATGTGTCTGCACAGGCCAGCTTCAGGA GGCAGGGACCTCACAGAAGTAGTGGTCAAT 2014-07-19 2014-07-19
snp_cf0021000878949 FAMICHN00001 C GGGATGTGTCTGCACAGGCCAGCTTCAGGA GGCAGGGACCTCACAGAAGTAGTGGTCAAT 2014-07-19 2014-07-19
snp_cf0022000816175 FAMICHN00002 Y GGGATGTGTCTGCACAGGCCAGCTTCAGGA GGCAGGGACCTCACAGAAGTAGTGGTCAAT 2014-07-19 2014-07-19
snp_cf0011000927506 DQ3 Y GGGATGTGTCTGCACAGGCCAGCTTCAGGA GGCAGGGACCTCACAGAAGTAGTGGTCAAT 2014-07-19 2014-07-19
snp_cf0023000871057 FAMICHN00003 Y GGGATGTGTCTGCACAGGCCAGCTTCAGGA GGCAGGGACCTCACAGAAGTAGTGGTCAAT 2014-07-19 2014-07-19
snp_cf0035000894483 KM10 Y GGGATGTGTCTGCACAGGCCAGCTTCAGGA GGCAGGGACCTCACAGAAGTAGTGGTCAAT 2014-07-19 2014-07-19
snp_cf0033000720768 GS9 C GGGATGTGTCTGCACAGGCCAGCTTCAGGA GGCAGGGACCTCACAGAAGTAGTGGTCAAT 2014-07-19 2014-07-19
snp_cf0027000719066 GS3 C GGGATGTGTCTGCACAGGCCAGCTTCAGGA GGCAGGGACCTCACAGAAGTAGTGGTCAAT 2014-07-19 2014-07-19
snp_cf0058001147140 LUPWRUS00003 Y GGGATGTGTCTGCACAGGCCAGCTTCAGGA GGCAGGGACCTCACAGAAGTAGTGGTCAAT 2014-07-19 2014-07-19
snp_cf0007000775858 Dingo Y GGGATGTGTCTGCACAGGCCAGCTTCAGGA GGCAGGGACCTCACAGAAGTAGTGGTCAAT 2014-07-19 2014-07-19
snp_cf0008000905994 DQ10 Y GGGATGTGTCTGCACAGGCCAGCTTCAGGA GGCAGGGACCTCACAGAAGTAGTGGTCAAT 2014-07-19 2014-07-19
snp_cf0020000911355 FAMBTIM00001 C GGGATGTGTCTGCACAGGCCAGCTTCAGGA GGCAGGGACCTCACAGAAGTAGTGGTCAAT 2014-07-19 2014-07-19
snp_cf0068000881201 TM9 C GGGATGTGTCTGCACAGGCCAGCTTCAGGA GGCAGGGACCTCACAGAAGTAGTGGTCAAT 2014-07-19 2014-07-19
snp_cf0077000937258 YJ8 Y GGGATGTGTCTGCACAGGCCAGCTTCAGGA GGCAGGGACCTCACAGAAGTAGTGGTCAAT 2014-07-19 2014-07-19
snp_cf0029000662961 GS5 C GGGATGTGTCTGCACAGGCCAGCTTCAGGA GGCAGGGACCTCACAGAAGTAGTGGTCAAT 2014-07-19 2014-07-19
snp_cf0070000967528 YJ1 Y GGGATGTGTCTGCACAGGCCAGCTTCAGGA GGCAGGGACCTCACAGAAGTAGTGGTCAAT 2014-07-19 2014-07-19
snp_cf0061000932188 TM2 Y GGGATGTGTCTGCACAGGCCAGCTTCAGGA GGCAGGGACCTCACAGAAGTAGTGGTCAAT 2014-07-19 2014-07-19
snp_cf0044000817837 KM9 Y GGGATGTGTCTGCACAGGCCAGCTTCAGGA GGCAGGGACCTCACAGAAGTAGTGGTCAAT 2014-07-19 2014-07-19
snp_cf0040000820758 KM5 C GGGATGTGTCTGCACAGGCCAGCTTCAGGA GGCAGGGACCTCACAGAAGTAGTGGTCAAT 2014-07-19 2014-07-19
snp_cf0060000924589 TM1 C GGGATGTGTCTGCACAGGCCAGCTTCAGGA GGCAGGGACCTCACAGAAGTAGTGGTCAAT 2014-07-19 2014-07-19
snp_cf0067000883887 TM8 Y GGGATGTGTCTGCACAGGCCAGCTTCAGGA GGCAGGGACCTCACAGAAGTAGTGGTCAAT 2014-07-19 2014-07-19
snp_cf0048000876907 LJ3 Y GGGATGTGTCTGCACAGGCCAGCTTCAGGA GGCAGGGACCTCACAGAAGTAGTGGTCAAT 2014-07-19 2014-07-19
snp_cf0051000920741 LJ6 Y GGGATGTGTCTGCACAGGCCAGCTTCAGGA GGCAGGGACCTCACAGAAGTAGTGGTCAAT 2014-07-19 2014-07-19
snp_cf0041000901655 KM6 Y GGGATGTGTCTGCACAGGCCAGCTTCAGGA GGCAGGGACCTCACAGAAGTAGTGGTCAAT 2014-07-19 2014-07-19
snp_cf0005001130466 CHW C GGGATGTGTCTGCACAGGCCAGCTTCAGGA GGCAGGGACCTCACAGAAGTAGTGGTCAAT 2014-07-19 2014-07-19
snp_cf0015000919977 DQ7 C GGGATGTGTCTGCACAGGCCAGCTTCAGGA GGCAGGGACCTCACAGAAGTAGTGGTCAAT 2014-07-19 2014-07-19
snp_cf0057001112712 LUPWRUS00002 C GGGATGTGTCTGCACAGGCCAGCTTCAGGA GGCAGGGACCTCACAGAAGTAGTGGTCAAT 2014-07-19 2014-07-19
snp_cf0014000907322 DQ6 Y GGGATGTGTCTGCACAGGCCAGCTTCAGGA GGCAGGGACCTCACAGAAGTAGTGGTCAAT 2014-07-19 2014-07-19
snp_cf0016000916884 DQ8 Y GGGATGTGTCTGCACAGGCCAGCTTCAGGA GGCAGGGACCTCACAGAAGTAGTGGTCAAT 2014-07-19 2014-07-19
snp_cf0004000758290 Basenji C GGGATGTGTCTGCACAGGCCAGCTTCAGGA GGCAGGGACCTCACAGAAGTAGTGGTCAAT 2014-07-19 2014-07-19
snp_cf0072000941434 YJ3 C GGGATGTGTCTGCACAGGCCAGCTTCAGGA GGCAGGGACCTCACAGAAGTAGTGGTCAAT 2014-07-19 2014-07-19
snp_cf0009000923767 DQ1 C GGGATGTGTCTGCACAGGCCAGCTTCAGGA GGCAGGGACCTCACAGAAGTAGTGGTCAAT 2014-07-19 2014-07-19
snp_cf0012000922729 DQ4 Y GGGATGTGTCTGCACAGGCCAGCTTCAGGA GGCAGGGACCTCACAGAAGTAGTGGTCAAT 2014-07-19 2014-07-19
snp_cf0028000686971 GS4 C GGGATGTGTCTGCACAGGCCAGCTTCAGGA GGCAGGGACCTCACAGAAGTAGTGGTCAAT 2014-07-19 2014-07-19
snp_cf0030000740039 GS6 C GGGATGTGTCTGCACAGGCCAGCTTCAGGA GGCAGGGACCTCACAGAAGTAGTGGTCAAT 2014-07-19 2014-07-19
snp_cf0024000748196 GS10 C GGGATGTGTCTGCACAGGCCAGCTTCAGGA GGCAGGGACCTCACAGAAGTAGTGGTCAAT 2014-07-19 2014-07-19
snp_cf0019000720256 FAMBGSD00001 C GGGATGTGTCTGCACAGGCCAGCTTCAGGA GGCAGGGACCTCACAGAAGTAGTGGTCAAT 2014-07-19 2014-07-19
snp_cf0001000388281 solidGW1 Y GGGATGTGTCTGCACAGGCCAGCTTCAGGA GGCAGGGACCTCACAGAAGTAGTGGTCAAT 2014-08-01 2014-08-01
snp_cf0039000730424 KM4 C GGGATGTGTCTGCACAGGCCAGCTTCAGGA GGCAGGGACCTCACAGAAGTAGTGGTCAAT 2014-07-19 2014-07-19
snp_cf0031000737915 GS7 C GGGATGTGTCTGCACAGGCCAGCTTCAGGA GGCAGGGACCTCACAGAAGTAGTGGTCAAT 2014-07-19 2014-07-19
snp_cf0043000762137 KM8 C GGGATGTGTCTGCACAGGCCAGCTTCAGGA GGCAGGGACCTCACAGAAGTAGTGGTCAAT 2014-07-19 2014-07-19
snp_cf0066000937702 TM7 Y GGGATGTGTCTGCACAGGCCAGCTTCAGGA GGCAGGGACCTCACAGAAGTAGTGGTCAAT 2014-07-19 2014-07-19
snp_cf0059000929489 TM10 Y GGGATGTGTCTGCACAGGCCAGCTTCAGGA GGCAGGGACCTCACAGAAGTAGTGGTCAAT 2014-07-19 2014-07-19
snp_cf0064000928026 TM5 Y GGGATGTGTCTGCACAGGCCAGCTTCAGGA GGCAGGGACCTCACAGAAGTAGTGGTCAAT 2014-07-19 2014-07-19
snp_cf0055001152525 LUPWCHN00001 Y GGGATGTGTCTGCACAGGCCAGCTTCAGGA GGCAGGGACCTCACAGAAGTAGTGGTCAAT 2014-07-19 2014-07-19
snp_cf0026000711471 GS2 C GGGATGTGTCTGCACAGGCCAGCTTCAGGA GGCAGGGACCTCACAGAAGTAGTGGTCAAT 2014-07-19 2014-07-19
6.Fasta Information
GAAGTCCACC AAGTCATTGA GGGATGTGTC TGCACAGGCC AGCTTCAGGA
C
GGCAGGGACC TCACAGAAGT AGTGGTCAAT TTCATTAGGG CCACAGTAGG