e.g. 1:1246..9423
SNP Detail For snp_cf0018000764761    [See in GBrowse]
1.General Information
SNP ID: snp_cf0018000764761
Organism: Canis familiaris
Individual: FAMBBEM00001
Create time: 2014-07-19
Last update: 2014-07-19
NCBI rs link rs8817519  
2.Allele Information
Platform: SOLEXA
Method: sequence
SNP Class: snp
Genotype: A
5'flank: CTAGTTAAGGAGATGTATATGAAGCATCCA
3'flank: CACAGGCTGCAGGAAGCTAGTTGCCTCACT
3.Reference Map information
Chrom Position Reference FAMBBEM00001
Chr15 340649 G A
4.Gene information
Gene model(s)
Gene ID Position in Gene Strands Gene Allele Location
ENSCAFG00000002491 5148 + G intron
Transcript Protein
SNP to transcript Accession Position in Transcript Allele change Accession Position in Protein Residue change
NA NA NA NA NA NA NA
5.SNPs of other individuals in this position
SNP_ID Individual Genotype 5' Near Seq 30 bp 3' Near Seq 30 bp Create time Last update time
snp_cf0007000775931 Dingo R CTAGTTAAGGAGATGTATATGAAGCATCCA CACAGGCTGCAGGAAGCTAGTTGCCTCACT 2014-07-19 2014-07-19
snp_cf0017000935148 DQ9 A CTAGTTAAGGAGATGTATATGAAGCATCCA CACAGGCTGCAGGAAGCTAGTTGCCTCACT 2014-07-19 2014-07-19
snp_cf0027000719138 GS3 A CTAGTTAAGGAGATGTATATGAAGCATCCA CACAGGCTGCAGGAAGCTAGTTGCCTCACT 2014-07-19 2014-07-19
snp_cf0029000663036 GS5 A CTAGTTAAGGAGATGTATATGAAGCATCCA CACAGGCTGCAGGAAGCTAGTTGCCTCACT 2014-07-19 2014-07-19
snp_cf0063000903193 TM4 R CTAGTTAAGGAGATGTATATGAAGCATCCA CACAGGCTGCAGGAAGCTAGTTGCCTCACT 2014-07-19 2014-07-19
snp_cf0009000923858 DQ1 A CTAGTTAAGGAGATGTATATGAAGCATCCA CACAGGCTGCAGGAAGCTAGTTGCCTCACT 2014-07-19 2014-07-19
snp_cf0056001167566 LUPWRUS00001 R CTAGTTAAGGAGATGTATATGAAGCATCCA CACAGGCTGCAGGAAGCTAGTTGCCTCACT 2014-07-19 2014-07-19
snp_cf0064000928110 TM5 R CTAGTTAAGGAGATGTATATGAAGCATCCA CACAGGCTGCAGGAAGCTAGTTGCCTCACT 2014-07-19 2014-07-19
snp_cf0057001112791 LUPWRUS00002 A CTAGTTAAGGAGATGTATATGAAGCATCCA CACAGGCTGCAGGAAGCTAGTTGCCTCACT 2014-07-19 2014-07-19
snp_cf0024000748268 GS10 A CTAGTTAAGGAGATGTATATGAAGCATCCA CACAGGCTGCAGGAAGCTAGTTGCCTCACT 2014-07-19 2014-07-19
snp_cf0004000758364 Basenji A CTAGTTAAGGAGATGTATATGAAGCATCCA CACAGGCTGCAGGAAGCTAGTTGCCTCACT 2014-07-19 2014-07-19
snp_cf0045000826391 LJ10 A CTAGTTAAGGAGATGTATATGAAGCATCCA CACAGGCTGCAGGAAGCTAGTTGCCTCACT 2014-07-19 2014-07-19
snp_cf0059000929573 TM10 R CTAGTTAAGGAGATGTATATGAAGCATCCA CACAGGCTGCAGGAAGCTAGTTGCCTCACT 2014-07-19 2014-07-19
snp_cf0074000935081 YJ5 R CTAGTTAAGGAGATGTATATGAAGCATCCA CACAGGCTGCAGGAAGCTAGTTGCCTCACT 2014-07-19 2014-07-19
snp_cf0050000851444 LJ5 R CTAGTTAAGGAGATGTATATGAAGCATCCA CACAGGCTGCAGGAAGCTAGTTGCCTCACT 2014-07-19 2014-07-19
snp_cf0068000881277 TM9 A CTAGTTAAGGAGATGTATATGAAGCATCCA CACAGGCTGCAGGAAGCTAGTTGCCTCACT 2014-07-19 2014-07-19
snp_cf0025000710484 GS1 A CTAGTTAAGGAGATGTATATGAAGCATCCA CACAGGCTGCAGGAAGCTAGTTGCCTCACT 2014-07-19 2014-07-19
snp_cf0058001147217 LUPWRUS00003 R CTAGTTAAGGAGATGTATATGAAGCATCCA CACAGGCTGCAGGAAGCTAGTTGCCTCACT 2014-07-19 2014-07-19
snp_cf0076000945456 YJ7 R CTAGTTAAGGAGATGTATATGAAGCATCCA CACAGGCTGCAGGAAGCTAGTTGCCTCACT 2014-07-19 2014-07-19
snp_cf0032000709662 GS8 A CTAGTTAAGGAGATGTATATGAAGCATCCA CACAGGCTGCAGGAAGCTAGTTGCCTCACT 2014-07-19 2014-07-19
snp_cf0062000922686 TM3 A CTAGTTAAGGAGATGTATATGAAGCATCCA CACAGGCTGCAGGAAGCTAGTTGCCTCACT 2014-07-19 2014-07-19
snp_cf0061000932310 TM2 R CTAGTTAAGGAGATGTATATGAAGCATCCA CACAGGCTGCAGGAAGCTAGTTGCCTCACT 2014-07-19 2014-07-19
snp_cf0035000894562 KM10 A CTAGTTAAGGAGATGTATATGAAGCATCCA CACAGGCTGCAGGAAGCTAGTTGCCTCACT 2014-07-19 2014-07-19
snp_cf0028000687044 GS4 A CTAGTTAAGGAGATGTATATGAAGCATCCA CACAGGCTGCAGGAAGCTAGTTGCCTCACT 2014-07-19 2014-07-19
snp_cf0036000740334 KM1 A CTAGTTAAGGAGATGTATATGAAGCATCCA CACAGGCTGCAGGAAGCTAGTTGCCTCACT 2014-07-19 2014-07-19
snp_cf0033000720840 GS9 A CTAGTTAAGGAGATGTATATGAAGCATCCA CACAGGCTGCAGGAAGCTAGTTGCCTCACT 2014-07-19 2014-07-19
snp_cf0020000911438 FAMBTIM00001 A CTAGTTAAGGAGATGTATATGAAGCATCCA CACAGGCTGCAGGAAGCTAGTTGCCTCACT 2014-07-19 2014-07-19
snp_cf0021000879042 FAMICHN00001 A CTAGTTAAGGAGATGTATATGAAGCATCCA CACAGGCTGCAGGAAGCTAGTTGCCTCACT 2014-07-19 2014-07-19
snp_cf0052000896896 LJ7 R CTAGTTAAGGAGATGTATATGAAGCATCCA CACAGGCTGCAGGAAGCTAGTTGCCTCACT 2014-07-19 2014-07-19
snp_cf0039000730506 KM4 A CTAGTTAAGGAGATGTATATGAAGCATCCA CACAGGCTGCAGGAAGCTAGTTGCCTCACT 2014-07-19 2014-07-19
snp_cf0011000927582 DQ3 R CTAGTTAAGGAGATGTATATGAAGCATCCA CACAGGCTGCAGGAAGCTAGTTGCCTCACT 2014-07-19 2014-07-19
snp_cf0072000941520 YJ3 A CTAGTTAAGGAGATGTATATGAAGCATCCA CACAGGCTGCAGGAAGCTAGTTGCCTCACT 2014-07-19 2014-07-19
snp_cf0019000720327 FAMBGSD00001 A CTAGTTAAGGAGATGTATATGAAGCATCCA CACAGGCTGCAGGAAGCTAGTTGCCTCACT 2014-07-19 2014-07-19
snp_cf0026000711543 GS2 A CTAGTTAAGGAGATGTATATGAAGCATCCA CACAGGCTGCAGGAAGCTAGTTGCCTCACT 2014-07-19 2014-07-19
snp_cf0067000883967 TM8 R CTAGTTAAGGAGATGTATATGAAGCATCCA CACAGGCTGCAGGAAGCTAGTTGCCTCACT 2014-07-19 2014-07-19
snp_cf0041000901736 KM6 R CTAGTTAAGGAGATGTATATGAAGCATCCA CACAGGCTGCAGGAAGCTAGTTGCCTCACT 2014-07-19 2014-07-19
snp_cf0002000599650 CID1 A CTAGTTAAGGAGATGTATATGAAGCATCCA CACAGGCTGCAGGAAGCTAGTTGCCTCACT 2014-08-02 2014-08-02
snp_cf0003000506030 dbSNP139 A CTAGTTAAGGAGATGTATATGAAGCATCCA CACAGGCTGCAGGAAGCTAGTTGCCTCACT 2014-07-19 2014-07-19
snp_cf0023000871129 FAMICHN00003 R CTAGTTAAGGAGATGTATATGAAGCATCCA CACAGGCTGCAGGAAGCTAGTTGCCTCACT 2014-07-19 2014-07-19
snp_cf0031000737987 GS7 A CTAGTTAAGGAGATGTATATGAAGCATCCA CACAGGCTGCAGGAAGCTAGTTGCCTCACT 2014-07-19 2014-07-19
snp_cf0043000762221 KM8 A CTAGTTAAGGAGATGTATATGAAGCATCCA CACAGGCTGCAGGAAGCTAGTTGCCTCACT 2014-07-19 2014-07-19
snp_cf0053000895585 LJ8 A CTAGTTAAGGAGATGTATATGAAGCATCCA CACAGGCTGCAGGAAGCTAGTTGCCTCACT 2014-07-19 2014-07-19
snp_cf0015000920053 DQ7 A CTAGTTAAGGAGATGTATATGAAGCATCCA CACAGGCTGCAGGAAGCTAGTTGCCTCACT 2014-07-19 2014-07-19
snp_cf0016000916962 DQ8 R CTAGTTAAGGAGATGTATATGAAGCATCCA CACAGGCTGCAGGAAGCTAGTTGCCTCACT 2014-07-19 2014-07-19
snp_cf0014000907404 DQ6 R CTAGTTAAGGAGATGTATATGAAGCATCCA CACAGGCTGCAGGAAGCTAGTTGCCTCACT 2014-07-19 2014-07-19
snp_cf0038000725158 KM3 A CTAGTTAAGGAGATGTATATGAAGCATCCA CACAGGCTGCAGGAAGCTAGTTGCCTCACT 2014-07-19 2014-07-19
snp_cf0042000933460 KM7 R CTAGTTAAGGAGATGTATATGAAGCATCCA CACAGGCTGCAGGAAGCTAGTTGCCTCACT 2014-07-19 2014-07-19
snp_cf0044000817911 KM9 R CTAGTTAAGGAGATGTATATGAAGCATCCA CACAGGCTGCAGGAAGCTAGTTGCCTCACT 2014-07-19 2014-07-19
snp_cf0022000816232 FAMICHN00002 R CTAGTTAAGGAGATGTATATGAAGCATCCA CACAGGCTGCAGGAAGCTAGTTGCCTCACT 2014-07-19 2014-07-19
snp_cf0077000937348 YJ8 R CTAGTTAAGGAGATGTATATGAAGCATCCA CACAGGCTGCAGGAAGCTAGTTGCCTCACT 2014-07-19 2014-07-19
snp_cf0005001130537 CHW A CTAGTTAAGGAGATGTATATGAAGCATCCA CACAGGCTGCAGGAAGCTAGTTGCCTCACT 2014-07-19 2014-07-19
snp_cf0048000876978 LJ3 R CTAGTTAAGGAGATGTATATGAAGCATCCA CACAGGCTGCAGGAAGCTAGTTGCCTCACT 2014-07-19 2014-07-19
snp_cf0030000740113 GS6 A CTAGTTAAGGAGATGTATATGAAGCATCCA CACAGGCTGCAGGAAGCTAGTTGCCTCACT 2014-07-19 2014-07-19
snp_cf0040000820841 KM5 A CTAGTTAAGGAGATGTATATGAAGCATCCA CACAGGCTGCAGGAAGCTAGTTGCCTCACT 2014-07-19 2014-07-19
snp_cf0060000924679 TM1 A CTAGTTAAGGAGATGTATATGAAGCATCCA CACAGGCTGCAGGAAGCTAGTTGCCTCACT 2014-07-19 2014-07-19
snp_cf0070000967595 YJ1 R CTAGTTAAGGAGATGTATATGAAGCATCCA CACAGGCTGCAGGAAGCTAGTTGCCTCACT 2014-07-19 2014-07-19
snp_cf0069000950521 YJ10 R CTAGTTAAGGAGATGTATATGAAGCATCCA CACAGGCTGCAGGAAGCTAGTTGCCTCACT 2014-07-19 2014-07-19
snp_cf0008000906076 DQ10 R CTAGTTAAGGAGATGTATATGAAGCATCCA CACAGGCTGCAGGAAGCTAGTTGCCTCACT 2014-07-19 2014-07-19
snp_cf0012000922808 DQ4 R CTAGTTAAGGAGATGTATATGAAGCATCCA CACAGGCTGCAGGAAGCTAGTTGCCTCACT 2014-07-19 2014-07-19
snp_cf0066000937786 TM7 R CTAGTTAAGGAGATGTATATGAAGCATCCA CACAGGCTGCAGGAAGCTAGTTGCCTCACT 2014-07-19 2014-07-19
6.Fasta Information
TGATCCTTCT CTTACAGAGA CTAGTTAAGG AGATGTATAT GAAGCATCCA
A
CACAGGCTGC AGGAAGCTAG TTGCCTCACT TTTCAGACCA GGAAGGCTGC