e.g. 1:1246..9423
SNP Detail For snp_cf0018000764762    [See in GBrowse]
1.General Information
SNP ID: snp_cf0018000764762
Organism: Canis familiaris
Individual: FAMBBEM00001
Create time: 2014-07-19
Last update: 2014-07-19
NCBI rs link rs22406816  
2.Allele Information
Platform: SOLEXA
Method: sequence
SNP Class: snp
Genotype: C
5'flank: CTTCCCCCAAGGCAAGGGCATCCTGTTGGC
3'flank: TACACTGTGGACGATGACTCCCGCTTCTTC
3.Reference Map information
Chrom Position Reference FAMBBEM00001
Chr15 341191 T C
4.Gene information
Gene model(s)
Gene ID Position in Gene Strands Gene Allele Location
ENSCAFG00000002491 5690 + T CDS
Transcript Protein
SNP to transcript Accession Position in Transcript Allele change Accession Position in Protein Residue change
+ ENSCAFT00000003927 1194 GCT => GCC ENSCAFP00000003629 398 A => A
5.SNPs of other individuals in this position
SNP_ID Individual Genotype 5' Near Seq 30 bp 3' Near Seq 30 bp Create time Last update time
snp_cf0007000775932 Dingo Y CTTCCCCCAAGGCAAGGGCATCCTGTTGGC TACACTGTGGACGATGACTCCCGCTTCTTC 2014-07-19 2014-07-19
snp_cf0027000719139 GS3 C CTTCCCCCAAGGCAAGGGCATCCTGTTGGC TACACTGTGGACGATGACTCCCGCTTCTTC 2014-07-19 2014-07-19
snp_cf0034001081656 ISW C CTTCCCCCAAGGCAAGGGCATCCTGTTGGC TACACTGTGGACGATGACTCCCGCTTCTTC 2014-07-19 2014-07-19
snp_cf0029000663037 GS5 C CTTCCCCCAAGGCAAGGGCATCCTGTTGGC TACACTGTGGACGATGACTCCCGCTTCTTC 2014-07-19 2014-07-19
snp_cf0009000923859 DQ1 C CTTCCCCCAAGGCAAGGGCATCCTGTTGGC TACACTGTGGACGATGACTCCCGCTTCTTC 2014-07-19 2014-07-19
snp_cf0017000935149 DQ9 C CTTCCCCCAAGGCAAGGGCATCCTGTTGGC TACACTGTGGACGATGACTCCCGCTTCTTC 2014-07-19 2014-07-19
snp_cf0056001167567 LUPWRUS00001 C CTTCCCCCAAGGCAAGGGCATCCTGTTGGC TACACTGTGGACGATGACTCCCGCTTCTTC 2014-07-19 2014-07-19
snp_cf0064000928111 TM5 C CTTCCCCCAAGGCAAGGGCATCCTGTTGGC TACACTGTGGACGATGACTCCCGCTTCTTC 2014-07-19 2014-07-19
snp_cf0024000748269 GS10 C CTTCCCCCAAGGCAAGGGCATCCTGTTGGC TACACTGTGGACGATGACTCCCGCTTCTTC 2014-07-19 2014-07-19
snp_cf0045000826392 LJ10 C CTTCCCCCAAGGCAAGGGCATCCTGTTGGC TACACTGTGGACGATGACTCCCGCTTCTTC 2014-07-19 2014-07-19
snp_cf0059000929574 TM10 C CTTCCCCCAAGGCAAGGGCATCCTGTTGGC TACACTGTGGACGATGACTCCCGCTTCTTC 2014-07-19 2014-07-19
snp_cf0004000758365 Basenji C CTTCCCCCAAGGCAAGGGCATCCTGTTGGC TACACTGTGGACGATGACTCCCGCTTCTTC 2014-07-19 2014-07-19
snp_cf0074000935082 YJ5 Y CTTCCCCCAAGGCAAGGGCATCCTGTTGGC TACACTGTGGACGATGACTCCCGCTTCTTC 2014-07-19 2014-07-19
snp_cf0025000710485 GS1 C CTTCCCCCAAGGCAAGGGCATCCTGTTGGC TACACTGTGGACGATGACTCCCGCTTCTTC 2014-07-19 2014-07-19
snp_cf0050000851445 LJ5 Y CTTCCCCCAAGGCAAGGGCATCCTGTTGGC TACACTGTGGACGATGACTCCCGCTTCTTC 2014-07-19 2014-07-19
snp_cf0068000881278 TM9 C CTTCCCCCAAGGCAAGGGCATCCTGTTGGC TACACTGTGGACGATGACTCCCGCTTCTTC 2014-07-19 2014-07-19
snp_cf0058001147218 LUPWRUS00003 C CTTCCCCCAAGGCAAGGGCATCCTGTTGGC TACACTGTGGACGATGACTCCCGCTTCTTC 2014-07-19 2014-07-19
snp_cf0032000709663 GS8 C CTTCCCCCAAGGCAAGGGCATCCTGTTGGC TACACTGTGGACGATGACTCCCGCTTCTTC 2014-07-19 2014-07-19
snp_cf0062000922687 TM3 Y CTTCCCCCAAGGCAAGGGCATCCTGTTGGC TACACTGTGGACGATGACTCCCGCTTCTTC 2014-07-19 2014-07-19
snp_cf0061000932311 TM2 Y CTTCCCCCAAGGCAAGGGCATCCTGTTGGC TACACTGTGGACGATGACTCCCGCTTCTTC 2014-07-19 2014-07-19
snp_cf0036000740335 KM1 C CTTCCCCCAAGGCAAGGGCATCCTGTTGGC TACACTGTGGACGATGACTCCCGCTTCTTC 2014-07-19 2014-07-19
snp_cf0028000687045 GS4 C CTTCCCCCAAGGCAAGGGCATCCTGTTGGC TACACTGTGGACGATGACTCCCGCTTCTTC 2014-07-19 2014-07-19
snp_cf0020000911439 FAMBTIM00001 C CTTCCCCCAAGGCAAGGGCATCCTGTTGGC TACACTGTGGACGATGACTCCCGCTTCTTC 2014-07-19 2014-07-19
snp_cf0033000720841 GS9 C CTTCCCCCAAGGCAAGGGCATCCTGTTGGC TACACTGTGGACGATGACTCCCGCTTCTTC 2014-07-19 2014-07-19
snp_cf0021000879043 FAMICHN00001 C CTTCCCCCAAGGCAAGGGCATCCTGTTGGC TACACTGTGGACGATGACTCCCGCTTCTTC 2014-07-19 2014-07-19
snp_cf0052000896897 LJ7 Y CTTCCCCCAAGGCAAGGGCATCCTGTTGGC TACACTGTGGACGATGACTCCCGCTTCTTC 2014-07-19 2014-07-19
snp_cf0039000730508 KM4 C CTTCCCCCAAGGCAAGGGCATCCTGTTGGC TACACTGTGGACGATGACTCCCGCTTCTTC 2014-07-19 2014-07-19
snp_cf0011000927583 DQ3 Y CTTCCCCCAAGGCAAGGGCATCCTGTTGGC TACACTGTGGACGATGACTCCCGCTTCTTC 2014-07-19 2014-07-19
snp_cf0023000871130 FAMICHN00003 Y CTTCCCCCAAGGCAAGGGCATCCTGTTGGC TACACTGTGGACGATGACTCCCGCTTCTTC 2014-07-19 2014-07-19
snp_cf0072000941521 YJ3 C CTTCCCCCAAGGCAAGGGCATCCTGTTGGC TACACTGTGGACGATGACTCCCGCTTCTTC 2014-07-19 2014-07-19
snp_cf0078000938430 YJ9 Y CTTCCCCCAAGGCAAGGGCATCCTGTTGGC TACACTGTGGACGATGACTCCCGCTTCTTC 2014-07-19 2014-07-19
snp_cf0001000388328 solidGW1 C CTTCCCCCAAGGCAAGGGCATCCTGTTGGC TACACTGTGGACGATGACTCCCGCTTCTTC 2014-08-01 2014-08-01
snp_cf0035000894563 KM10 Y CTTCCCCCAAGGCAAGGGCATCCTGTTGGC TACACTGTGGACGATGACTCCCGCTTCTTC 2014-07-19 2014-07-19
snp_cf0019000720328 FAMBGSD00001 C CTTCCCCCAAGGCAAGGGCATCCTGTTGGC TACACTGTGGACGATGACTCCCGCTTCTTC 2014-07-19 2014-07-19
snp_cf0071000939949 YJ2 Y CTTCCCCCAAGGCAAGGGCATCCTGTTGGC TACACTGTGGACGATGACTCCCGCTTCTTC 2014-07-19 2014-07-19
snp_cf0026000711544 GS2 C CTTCCCCCAAGGCAAGGGCATCCTGTTGGC TACACTGTGGACGATGACTCCCGCTTCTTC 2014-07-19 2014-07-19
snp_cf0067000883968 TM8 C CTTCCCCCAAGGCAAGGGCATCCTGTTGGC TACACTGTGGACGATGACTCCCGCTTCTTC 2014-07-19 2014-07-19
snp_cf0076000945457 YJ7 Y CTTCCCCCAAGGCAAGGGCATCCTGTTGGC TACACTGTGGACGATGACTCCCGCTTCTTC 2014-07-19 2014-07-19
snp_cf0041000901737 KM6 C CTTCCCCCAAGGCAAGGGCATCCTGTTGGC TACACTGTGGACGATGACTCCCGCTTCTTC 2014-07-19 2014-07-19
snp_cf0002000599651 CID1 C CTTCCCCCAAGGCAAGGGCATCCTGTTGGC TACACTGTGGACGATGACTCCCGCTTCTTC 2014-08-02 2014-08-02
snp_cf0003000506031 dbSNP139 C CTTCCCCCAAGGCAAGGGCATCCTGTTGGC TACACTGTGGACGATGACTCCCGCTTCTTC 2014-07-19 2014-07-19
snp_cf0031000737988 GS7 C CTTCCCCCAAGGCAAGGGCATCCTGTTGGC TACACTGTGGACGATGACTCCCGCTTCTTC 2014-07-19 2014-07-19
snp_cf0043000762222 KM8 C CTTCCCCCAAGGCAAGGGCATCCTGTTGGC TACACTGTGGACGATGACTCCCGCTTCTTC 2014-07-19 2014-07-19
snp_cf0060000924680 TM1 C CTTCCCCCAAGGCAAGGGCATCCTGTTGGC TACACTGTGGACGATGACTCCCGCTTCTTC 2014-07-19 2014-07-19
snp_cf0015000920054 DQ7 C CTTCCCCCAAGGCAAGGGCATCCTGTTGGC TACACTGTGGACGATGACTCCCGCTTCTTC 2014-07-19 2014-07-19
snp_cf0053000895586 LJ8 C CTTCCCCCAAGGCAAGGGCATCCTGTTGGC TACACTGTGGACGATGACTCCCGCTTCTTC 2014-07-19 2014-07-19
snp_cf0016000916963 DQ8 Y CTTCCCCCAAGGCAAGGGCATCCTGTTGGC TACACTGTGGACGATGACTCCCGCTTCTTC 2014-07-19 2014-07-19
snp_cf0042000933461 KM7 Y CTTCCCCCAAGGCAAGGGCATCCTGTTGGC TACACTGTGGACGATGACTCCCGCTTCTTC 2014-07-19 2014-07-19
snp_cf0044000817912 KM9 Y CTTCCCCCAAGGCAAGGGCATCCTGTTGGC TACACTGTGGACGATGACTCCCGCTTCTTC 2014-07-19 2014-07-19
snp_cf0014000907405 DQ6 Y CTTCCCCCAAGGCAAGGGCATCCTGTTGGC TACACTGTGGACGATGACTCCCGCTTCTTC 2014-07-19 2014-07-19
snp_cf0038000725159 KM3 C CTTCCCCCAAGGCAAGGGCATCCTGTTGGC TACACTGTGGACGATGACTCCCGCTTCTTC 2014-07-19 2014-07-19
snp_cf0057001112793 LUPWRUS00002 C CTTCCCCCAAGGCAAGGGCATCCTGTTGGC TACACTGTGGACGATGACTCCCGCTTCTTC 2014-07-19 2014-07-19
snp_cf0077000937349 YJ8 C CTTCCCCCAAGGCAAGGGCATCCTGTTGGC TACACTGTGGACGATGACTCCCGCTTCTTC 2014-07-19 2014-07-19
snp_cf0048000876979 LJ3 Y CTTCCCCCAAGGCAAGGGCATCCTGTTGGC TACACTGTGGACGATGACTCCCGCTTCTTC 2014-07-19 2014-07-19
snp_cf0051000920859 LJ6 Y CTTCCCCCAAGGCAAGGGCATCCTGTTGGC TACACTGTGGACGATGACTCCCGCTTCTTC 2014-07-19 2014-07-19
snp_cf0005001130539 CHW C CTTCCCCCAAGGCAAGGGCATCCTGTTGGC TACACTGTGGACGATGACTCCCGCTTCTTC 2014-07-19 2014-07-19
snp_cf0030000740114 GS6 C CTTCCCCCAAGGCAAGGGCATCCTGTTGGC TACACTGTGGACGATGACTCCCGCTTCTTC 2014-07-19 2014-07-19
snp_cf0066000937787 TM7 C CTTCCCCCAAGGCAAGGGCATCCTGTTGGC TACACTGTGGACGATGACTCCCGCTTCTTC 2014-07-19 2014-07-19
snp_cf0070000967596 YJ1 Y CTTCCCCCAAGGCAAGGGCATCCTGTTGGC TACACTGTGGACGATGACTCCCGCTTCTTC 2014-07-19 2014-07-19
snp_cf0040000820842 KM5 C CTTCCCCCAAGGCAAGGGCATCCTGTTGGC TACACTGTGGACGATGACTCCCGCTTCTTC 2014-07-19 2014-07-19
snp_cf0069000950522 YJ10 C CTTCCCCCAAGGCAAGGGCATCCTGTTGGC TACACTGTGGACGATGACTCCCGCTTCTTC 2014-07-19 2014-07-19
snp_cf0006001063820 CRW C CTTCCCCCAAGGCAAGGGCATCCTGTTGGC TACACTGTGGACGATGACTCCCGCTTCTTC 2014-07-19 2014-07-19
snp_cf0008000906077 DQ10 Y CTTCCCCCAAGGCAAGGGCATCCTGTTGGC TACACTGTGGACGATGACTCCCGCTTCTTC 2014-07-19 2014-07-19
snp_cf0012000922809 DQ4 C CTTCCCCCAAGGCAAGGGCATCCTGTTGGC TACACTGTGGACGATGACTCCCGCTTCTTC 2014-07-19 2014-07-19
snp_cf0055001152646 LUPWCHN00001 C CTTCCCCCAAGGCAAGGGCATCCTGTTGGC TACACTGTGGACGATGACTCCCGCTTCTTC 2014-07-19 2014-07-19
6.Fasta Information
ATCTACTACC CTAGCCACAG CTTCCCCCAA GGCAAGGGCA TCCTGTTGGC
C
TACACTGTGG ACGATGACTC CCGCTTCTTC ACATCCATGA CGCACGAGCA