e.g. 1:1246..9423
SNP Detail For snp_cf0018000764857    [See in GBrowse]
1.General Information
SNP ID: snp_cf0018000764857
Organism: Canis familiaris
Individual: FAMBBEM00001
Create time: 2014-07-19
Last update: 2014-07-19
2.Allele Information
Platform: SOLEXA
Method: sequence
SNP Class: snp
Genotype: R
5'flank: CACCGGGAGCCCGATGTGGGATTCGATCCC
3'flank: GGTCTCCAGGATCGCGCCCTGGGCCAAAGG
3.Reference Map information
Chrom Position Reference FAMBBEM00001
Chr15 468464 A R
4.Gene information
Gene model(s)
Gene ID Position in Gene Strands Gene Allele Location
ENSCAFG00000002500 4548 + A intron
Transcript Protein
SNP to transcript Accession Position in Transcript Allele change Accession Position in Protein Residue change
NA NA NA NA NA NA NA
5.SNPs of other individuals in this position
SNP_ID Individual Genotype 5' Near Seq 30 bp 3' Near Seq 30 bp Create time Last update time
snp_cf0022000816312 FAMICHN00002 R CACCGGGAGCCCGATGTGGGATTCGATCCC GGTCTCCAGGATCGCGCCCTGGGCCAAAGG 2014-07-19 2014-07-19
snp_cf0014000907495 DQ6 R CACCGGGAGCCCGATGTGGGATTCGATCCC GGTCTCCAGGATCGCGCCCTGGGCCAAAGG 2014-07-19 2014-07-19
snp_cf0015000920141 DQ7 G CACCGGGAGCCCGATGTGGGATTCGATCCC GGTCTCCAGGATCGCGCCCTGGGCCAAAGG 2014-07-19 2014-07-19
snp_cf0068000881365 TM9 G CACCGGGAGCCCGATGTGGGATTCGATCCC GGTCTCCAGGATCGCGCCCTGGGCCAAAGG 2014-07-19 2014-07-19
snp_cf0039000730604 KM4 R CACCGGGAGCCCGATGTGGGATTCGATCCC GGTCTCCAGGATCGCGCCCTGGGCCAAAGG 2014-07-19 2014-07-19
snp_cf0042000933553 KM7 R CACCGGGAGCCCGATGTGGGATTCGATCCC GGTCTCCAGGATCGCGCCCTGGGCCAAAGG 2014-07-19 2014-07-19
snp_cf0023000871224 FAMICHN00003 R CACCGGGAGCCCGATGTGGGATTCGATCCC GGTCTCCAGGATCGCGCCCTGGGCCAAAGG 2014-07-19 2014-07-19
snp_cf0021000879136 FAMICHN00001 R CACCGGGAGCCCGATGTGGGATTCGATCCC GGTCTCCAGGATCGCGCCCTGGGCCAAAGG 2014-07-19 2014-07-19
snp_cf0041000901835 KM6 R CACCGGGAGCCCGATGTGGGATTCGATCCC GGTCTCCAGGATCGCGCCCTGGGCCAAAGG 2014-07-19 2014-07-19
snp_cf0066000937887 TM7 G CACCGGGAGCCCGATGTGGGATTCGATCCC GGTCTCCAGGATCGCGCCCTGGGCCAAAGG 2014-07-19 2014-07-19
snp_cf0016000917051 DQ8 R CACCGGGAGCCCGATGTGGGATTCGATCCC GGTCTCCAGGATCGCGCCCTGGGCCAAAGG 2014-07-19 2014-07-19
snp_cf0059000929674 TM10 R CACCGGGAGCCCGATGTGGGATTCGATCCC GGTCTCCAGGATCGCGCCCTGGGCCAAAGG 2014-07-19 2014-07-19
snp_cf0043000762332 KM8 R CACCGGGAGCCCGATGTGGGATTCGATCCC GGTCTCCAGGATCGCGCCCTGGGCCAAAGG 2014-07-19 2014-07-19
snp_cf0004000758452 Basenji G CACCGGGAGCCCGATGTGGGATTCGATCCC GGTCTCCAGGATCGCGCCCTGGGCCAAAGG 2014-07-19 2014-07-19
6.Fasta Information
AGGGAGAAGC AGGCTCCATG CACCGGGAGC CCGATGTGGG ATTCGATCCC
R
GGTCTCCAGG ATCGCGCCCT GGGCCAAAGG CAGGCGCCAA ACCGTTCCGC