e.g. 1:1246..9423
SNP Detail For snp_cf0018000764859    [See in GBrowse]
1.General Information
SNP ID: snp_cf0018000764859
Organism: Canis familiaris
Individual: FAMBBEM00001
Create time: 2014-07-19
Last update: 2014-07-19
2.Allele Information
Platform: SOLEXA
Method: sequence
SNP Class: snp
Genotype: G
5'flank: TGCTCCCCCGTGGCAAGGTATGGTGAGACC
3'flank: GCCAAGTTCCCCAACTCAAAGTGGTGGCTA
3.Reference Map information
Chrom Position Reference FAMBBEM00001
Chr15 468906 C G
4.Gene information
Gene model(s)
Gene ID Position in Gene Strands Gene Allele Location
ENSCAFG00000002500 4990 + C intron
Transcript Protein
SNP to transcript Accession Position in Transcript Allele change Accession Position in Protein Residue change
NA NA NA NA NA NA NA
5.SNPs of other individuals in this position
SNP_ID Individual Genotype 5' Near Seq 30 bp 3' Near Seq 30 bp Create time Last update time
snp_cf0050000851536 LJ5 S TGCTCCCCCGTGGCAAGGTATGGTGAGACC GCCAAGTTCCCCAACTCAAAGTGGTGGCTA 2014-07-19 2014-07-19
snp_cf0063000903233 TM4 S TGCTCCCCCGTGGCAAGGTATGGTGAGACC GCCAAGTTCCCCAACTCAAAGTGGTGGCTA 2014-07-19 2014-07-19
snp_cf0014000907497 DQ6 S TGCTCCCCCGTGGCAAGGTATGGTGAGACC GCCAAGTTCCCCAACTCAAAGTGGTGGCTA 2014-07-19 2014-07-19
snp_cf0068000881367 TM9 G TGCTCCCCCGTGGCAAGGTATGGTGAGACC GCCAAGTTCCCCAACTCAAAGTGGTGGCTA 2014-07-19 2014-07-19
snp_cf0071000940040 YJ2 S TGCTCCCCCGTGGCAAGGTATGGTGAGACC GCCAAGTTCCCCAACTCAAAGTGGTGGCTA 2014-07-19 2014-07-19
snp_cf0064000928209 TM5 S TGCTCCCCCGTGGCAAGGTATGGTGAGACC GCCAAGTTCCCCAACTCAAAGTGGTGGCTA 2014-07-19 2014-07-19
snp_cf0062000922736 TM3 S TGCTCCCCCGTGGCAAGGTATGGTGAGACC GCCAAGTTCCCCAACTCAAAGTGGTGGCTA 2014-07-19 2014-07-19
snp_cf0072000941620 YJ3 G TGCTCCCCCGTGGCAAGGTATGGTGAGACC GCCAAGTTCCCCAACTCAAAGTGGTGGCTA 2014-07-19 2014-07-19
snp_cf0015000920143 DQ7 G TGCTCCCCCGTGGCAAGGTATGGTGAGACC GCCAAGTTCCCCAACTCAAAGTGGTGGCTA 2014-07-19 2014-07-19
snp_cf0077000937454 YJ8 S TGCTCCCCCGTGGCAAGGTATGGTGAGACC GCCAAGTTCCCCAACTCAAAGTGGTGGCTA 2014-07-19 2014-07-19
snp_cf0023000871226 FAMICHN00003 S TGCTCCCCCGTGGCAAGGTATGGTGAGACC GCCAAGTTCCCCAACTCAAAGTGGTGGCTA 2014-07-19 2014-07-19
snp_cf0012000922899 DQ4 G TGCTCCCCCGTGGCAAGGTATGGTGAGACC GCCAAGTTCCCCAACTCAAAGTGGTGGCTA 2014-07-19 2014-07-19
snp_cf0041000901837 KM6 S TGCTCCCCCGTGGCAAGGTATGGTGAGACC GCCAAGTTCCCCAACTCAAAGTGGTGGCTA 2014-07-19 2014-07-19
snp_cf0059000929676 TM10 S TGCTCCCCCGTGGCAAGGTATGGTGAGACC GCCAAGTTCCCCAACTCAAAGTGGTGGCTA 2014-07-19 2014-07-19
snp_cf0070000967688 YJ1 S TGCTCCCCCGTGGCAAGGTATGGTGAGACC GCCAAGTTCCCCAACTCAAAGTGGTGGCTA 2014-07-19 2014-07-19
snp_cf0074000935181 YJ5 S TGCTCCCCCGTGGCAAGGTATGGTGAGACC GCCAAGTTCCCCAACTCAAAGTGGTGGCTA 2014-07-19 2014-07-19
snp_cf0034001081744 ISW G TGCTCCCCCGTGGCAAGGTATGGTGAGACC GCCAAGTTCCCCAACTCAAAGTGGTGGCTA 2014-07-19 2014-07-19
snp_cf0056001167658 LUPWRUS00001 S TGCTCCCCCGTGGCAAGGTATGGTGAGACC GCCAAGTTCCCCAACTCAAAGTGGTGGCTA 2014-07-19 2014-07-19
snp_cf0021000879139 FAMICHN00001 G TGCTCCCCCGTGGCAAGGTATGGTGAGACC GCCAAGTTCCCCAACTCAAAGTGGTGGCTA 2014-07-19 2014-07-19
snp_cf0058001147317 LUPWRUS00003 S TGCTCCCCCGTGGCAAGGTATGGTGAGACC GCCAAGTTCCCCAACTCAAAGTGGTGGCTA 2014-07-19 2014-07-19
snp_cf0057001112893 LUPWRUS00002 G TGCTCCCCCGTGGCAAGGTATGGTGAGACC GCCAAGTTCCCCAACTCAAAGTGGTGGCTA 2014-07-19 2014-07-19
snp_cf0002000599717 CID1 S TGCTCCCCCGTGGCAAGGTATGGTGAGACC GCCAAGTTCCCCAACTCAAAGTGGTGGCTA 2014-08-02 2014-08-02
snp_cf0017000935259 DQ9 G TGCTCCCCCGTGGCAAGGTATGGTGAGACC GCCAAGTTCCCCAACTCAAAGTGGTGGCTA 2014-07-19 2014-07-19
snp_cf0035000894611 KM10 S TGCTCCCCCGTGGCAAGGTATGGTGAGACC GCCAAGTTCCCCAACTCAAAGTGGTGGCTA 2014-07-19 2014-07-19
snp_cf0076000945593 YJ7 S TGCTCCCCCGTGGCAAGGTATGGTGAGACC GCCAAGTTCCCCAACTCAAAGTGGTGGCTA 2014-07-19 2014-07-19
snp_cf0004000758454 Basenji G TGCTCCCCCGTGGCAAGGTATGGTGAGACC GCCAAGTTCCCCAACTCAAAGTGGTGGCTA 2014-07-19 2014-07-19
snp_cf0007000776022 Dingo S TGCTCCCCCGTGGCAAGGTATGGTGAGACC GCCAAGTTCCCCAACTCAAAGTGGTGGCTA 2014-07-19 2014-07-19
snp_cf0020000911534 FAMBTIM00001 S TGCTCCCCCGTGGCAAGGTATGGTGAGACC GCCAAGTTCCCCAACTCAAAGTGGTGGCTA 2014-07-19 2014-07-19
snp_cf0043000762334 KM8 S TGCTCCCCCGTGGCAAGGTATGGTGAGACC GCCAAGTTCCCCAACTCAAAGTGGTGGCTA 2014-07-19 2014-07-19
snp_cf0065000900381 TM6 G TGCTCCCCCGTGGCAAGGTATGGTGAGACC GCCAAGTTCCCCAACTCAAAGTGGTGGCTA 2014-07-19 2014-07-19
snp_cf0061000932437 TM2 S TGCTCCCCCGTGGCAAGGTATGGTGAGACC GCCAAGTTCCCCAACTCAAAGTGGTGGCTA 2014-07-19 2014-07-19
snp_cf0066000937889 TM7 S TGCTCCCCCGTGGCAAGGTATGGTGAGACC GCCAAGTTCCCCAACTCAAAGTGGTGGCTA 2014-07-19 2014-07-19
snp_cf0016000917053 DQ8 S TGCTCCCCCGTGGCAAGGTATGGTGAGACC GCCAAGTTCCCCAACTCAAAGTGGTGGCTA 2014-07-19 2014-07-19
snp_cf0069000950626 YJ10 G TGCTCCCCCGTGGCAAGGTATGGTGAGACC GCCAAGTTCCCCAACTCAAAGTGGTGGCTA 2014-07-19 2014-07-19
snp_cf0005001130630 CHW G TGCTCCCCCGTGGCAAGGTATGGTGAGACC GCCAAGTTCCCCAACTCAAAGTGGTGGCTA 2014-07-19 2014-07-19
6.Fasta Information
GAGCTGTAGA GCTGGACGCC TGCTCCCCCG TGGCAAGGTA TGGTGAGACC
G
GCCAAGTTCC CCAACTCAAA GTGGTGGCTA TTTATGTGGG AAGACCCTTT