e.g. 1:1246..9423
SNP Detail For snp_cf0019000385655    [See in GBrowse]
1.General Information
SNP ID: snp_cf0019000385655
Organism: Canis familiaris
Individual: FAMBGSD00001
Create time: 2014-07-19
Last update: 2014-07-19
NCBI rs link rs24766117  
2.Allele Information
Platform: SOLEXA
Method: sequence
SNP Class: snp
Genotype: A
5'flank: AACTCTGACATCAGCCCGCAGACAGTCTGG
3'flank: ACAGTGGGAGGAAGAGGCGATGTGTCTCCC
3.Reference Map information
Chrom Position Reference FAMBGSD00001
Chr12 109419 G A
4.Gene information
Gene model(s)
Gene ID Position in Gene Strands Gene Allele Location
ENSCAFG00000000367 72469 - G CDS
Transcript Protein
SNP to transcript Accession Position in Transcript Allele change Accession Position in Protein Residue change
- ENSCAFT00000000005 660 GTC => GTT ENSCAFP00000000005 220 V => V
- ENSCAFT00000000580 1986 GTC => GTT ENSCAFP00000000528 662 V => V
5.SNPs of other individuals in this position
SNP_ID Individual Genotype 5' Near Seq 30 bp 3' Near Seq 30 bp Create time Last update time
snp_cf0064000514234 TM5 R AACTCTGACATCAGCCCGCAGACAGTCTGG ACAGTGGGAGGAAGAGGCGATGTGTCTCCC 2014-07-19 2014-07-19
snp_cf0023000475885 FAMICHN00003 A AACTCTGACATCAGCCCGCAGACAGTCTGG ACAGTGGGAGGAAGAGGCGATGTGTCTCCC 2014-07-19 2014-07-19
snp_cf0038000404240 KM3 A AACTCTGACATCAGCCCGCAGACAGTCTGG ACAGTGGGAGGAAGAGGCGATGTGTCTCCC 2014-07-19 2014-07-19
snp_cf0074000515734 YJ5 R AACTCTGACATCAGCCCGCAGACAGTCTGG ACAGTGGGAGGAAGAGGCGATGTGTCTCCC 2014-07-19 2014-07-19
snp_cf0057000630633 LUPWRUS00002 R AACTCTGACATCAGCCCGCAGACAGTCTGG ACAGTGGGAGGAAGAGGCGATGTGTCTCCC 2014-07-19 2014-07-19
snp_cf0072000524302 YJ3 R AACTCTGACATCAGCCCGCAGACAGTCTGG ACAGTGGGAGGAAGAGGCGATGTGTCTCCC 2014-07-19 2014-07-19
snp_cf0037000411642 KM2 A AACTCTGACATCAGCCCGCAGACAGTCTGG ACAGTGGGAGGAAGAGGCGATGTGTCTCCC 2014-07-19 2014-07-19
snp_cf0061000514553 TM2 R AACTCTGACATCAGCCCGCAGACAGTCTGG ACAGTGGGAGGAAGAGGCGATGTGTCTCCC 2014-07-19 2014-07-19
snp_cf0046000454129 LJ1 A AACTCTGACATCAGCCCGCAGACAGTCTGG ACAGTGGGAGGAAGAGGCGATGTGTCTCCC 2014-07-19 2014-07-19
snp_cf0032000382609 GS8 A AACTCTGACATCAGCCCGCAGACAGTCTGG ACAGTGGGAGGAAGAGGCGATGTGTCTCCC 2014-07-19 2014-07-19
snp_cf0044000444411 KM9 R AACTCTGACATCAGCCCGCAGACAGTCTGG ACAGTGGGAGGAAGAGGCGATGTGTCTCCC 2014-07-19 2014-07-19
snp_cf0022000471148 FAMICHN00002 A AACTCTGACATCAGCCCGCAGACAGTCTGG ACAGTGGGAGGAAGAGGCGATGTGTCTCCC 2014-07-19 2014-07-19
snp_cf0067000502371 TM8 A AACTCTGACATCAGCCCGCAGACAGTCTGG ACAGTGGGAGGAAGAGGCGATGTGTCTCCC 2014-07-19 2014-07-19
snp_cf0015000506218 DQ7 R AACTCTGACATCAGCCCGCAGACAGTCTGG ACAGTGGGAGGAAGAGGCGATGTGTCTCCC 2014-07-19 2014-07-19
snp_cf0073000513970 YJ4 R AACTCTGACATCAGCCCGCAGACAGTCTGG ACAGTGGGAGGAAGAGGCGATGTGTCTCCC 2014-07-19 2014-07-19
snp_cf0039000401856 KM4 A AACTCTGACATCAGCCCGCAGACAGTCTGG ACAGTGGGAGGAAGAGGCGATGTGTCTCCC 2014-07-19 2014-07-19
snp_cf0053000492441 LJ8 R AACTCTGACATCAGCCCGCAGACAGTCTGG ACAGTGGGAGGAAGAGGCGATGTGTCTCCC 2014-07-19 2014-07-19
snp_cf0024000418954 GS10 R AACTCTGACATCAGCCCGCAGACAGTCTGG ACAGTGGGAGGAAGAGGCGATGTGTCTCCC 2014-07-19 2014-07-19
snp_cf0018000418516 FAMBBEM00001 R AACTCTGACATCAGCCCGCAGACAGTCTGG ACAGTGGGAGGAAGAGGCGATGTGTCTCCC 2014-07-19 2014-07-19
snp_cf0060000521206 TM1 R AACTCTGACATCAGCCCGCAGACAGTCTGG ACAGTGGGAGGAAGAGGCGATGTGTCTCCC 2014-07-19 2014-07-19
snp_cf0009000505271 DQ1 R AACTCTGACATCAGCCCGCAGACAGTCTGG ACAGTGGGAGGAAGAGGCGATGTGTCTCCC 2014-07-19 2014-07-19
snp_cf0049000520294 LJ4 R AACTCTGACATCAGCCCGCAGACAGTCTGG ACAGTGGGAGGAAGAGGCGATGTGTCTCCC 2014-07-19 2014-07-19
snp_cf0047000476932 LJ2 A AACTCTGACATCAGCCCGCAGACAGTCTGG ACAGTGGGAGGAAGAGGCGATGTGTCTCCC 2014-07-19 2014-07-19
snp_cf0059000515410 TM10 A AACTCTGACATCAGCCCGCAGACAGTCTGG ACAGTGGGAGGAAGAGGCGATGTGTCTCCC 2014-07-19 2014-07-19
snp_cf0056000651745 LUPWRUS00001 A AACTCTGACATCAGCCCGCAGACAGTCTGG ACAGTGGGAGGAAGAGGCGATGTGTCTCCC 2014-07-19 2014-07-19
snp_cf0011000511087 DQ3 R AACTCTGACATCAGCCCGCAGACAGTCTGG ACAGTGGGAGGAAGAGGCGATGTGTCTCCC 2014-07-19 2014-07-19
snp_cf0003000275633 dbSNP139 A AACTCTGACATCAGCCCGCAGACAGTCTGG ACAGTGGGAGGAAGAGGCGATGTGTCTCCC 2014-07-19 2014-07-19
snp_cf0068000494091 TM9 A AACTCTGACATCAGCCCGCAGACAGTCTGG ACAGTGGGAGGAAGAGGCGATGTGTCTCCC 2014-07-19 2014-07-19
snp_cf0058000641524 LUPWRUS00003 R AACTCTGACATCAGCCCGCAGACAGTCTGG ACAGTGGGAGGAAGAGGCGATGTGTCTCCC 2014-07-19 2014-07-19
snp_cf0048000481638 LJ3 R AACTCTGACATCAGCCCGCAGACAGTCTGG ACAGTGGGAGGAAGAGGCGATGTGTCTCCC 2014-07-19 2014-07-19
snp_cf0025000371243 GS1 R AACTCTGACATCAGCCCGCAGACAGTCTGG ACAGTGGGAGGAAGAGGCGATGTGTCTCCC 2014-07-19 2014-07-19
snp_cf0008000501447 DQ10 R AACTCTGACATCAGCCCGCAGACAGTCTGG ACAGTGGGAGGAAGAGGCGATGTGTCTCCC 2014-07-19 2014-07-19
snp_cf0013000501075 DQ5 A AACTCTGACATCAGCCCGCAGACAGTCTGG ACAGTGGGAGGAAGAGGCGATGTGTCTCCC 2014-07-19 2014-07-19
snp_cf0017000522783 DQ9 A AACTCTGACATCAGCCCGCAGACAGTCTGG ACAGTGGGAGGAAGAGGCGATGTGTCTCCC 2014-07-19 2014-07-19
snp_cf0012000503679 DQ4 R AACTCTGACATCAGCCCGCAGACAGTCTGG ACAGTGGGAGGAAGAGGCGATGTGTCTCCC 2014-07-19 2014-07-19
snp_cf0005000626676 CHW A AACTCTGACATCAGCCCGCAGACAGTCTGG ACAGTGGGAGGAAGAGGCGATGTGTCTCCC 2014-07-19 2014-07-19
snp_cf0041000482271 KM6 A AACTCTGACATCAGCCCGCAGACAGTCTGG ACAGTGGGAGGAAGAGGCGATGTGTCTCCC 2014-07-19 2014-07-19
snp_cf0036000396288 KM1 A AACTCTGACATCAGCCCGCAGACAGTCTGG ACAGTGGGAGGAAGAGGCGATGTGTCTCCC 2014-07-19 2014-07-19
snp_cf0031000389524 GS7 R AACTCTGACATCAGCCCGCAGACAGTCTGG ACAGTGGGAGGAAGAGGCGATGTGTCTCCC 2014-07-19 2014-07-19
snp_cf0033000405610 GS9 R AACTCTGACATCAGCCCGCAGACAGTCTGG ACAGTGGGAGGAAGAGGCGATGTGTCTCCC 2014-07-19 2014-07-19
snp_cf0050000457148 LJ5 A AACTCTGACATCAGCCCGCAGACAGTCTGG ACAGTGGGAGGAAGAGGCGATGTGTCTCCC 2014-07-19 2014-07-19
snp_cf0075000527744 YJ6 R AACTCTGACATCAGCCCGCAGACAGTCTGG ACAGTGGGAGGAAGAGGCGATGTGTCTCCC 2014-07-19 2014-07-19
snp_cf0030000395158 GS6 R AACTCTGACATCAGCCCGCAGACAGTCTGG ACAGTGGGAGGAAGAGGCGATGTGTCTCCC 2014-07-19 2014-07-19
snp_cf0007000423364 Dingo R AACTCTGACATCAGCCCGCAGACAGTCTGG ACAGTGGGAGGAAGAGGCGATGTGTCTCCC 2014-07-19 2014-07-19
snp_cf0020000499784 FAMBTIM00001 A AACTCTGACATCAGCCCGCAGACAGTCTGG ACAGTGGGAGGAAGAGGCGATGTGTCTCCC 2014-07-19 2014-07-19
snp_cf0040000440297 KM5 A AACTCTGACATCAGCCCGCAGACAGTCTGG ACAGTGGGAGGAAGAGGCGATGTGTCTCCC 2014-07-19 2014-07-19
snp_cf0042000496582 KM7 A AACTCTGACATCAGCCCGCAGACAGTCTGG ACAGTGGGAGGAAGAGGCGATGTGTCTCCC 2014-07-19 2014-07-19
snp_cf0014000498734 DQ6 A AACTCTGACATCAGCCCGCAGACAGTCTGG ACAGTGGGAGGAAGAGGCGATGTGTCTCCC 2014-07-19 2014-07-19
snp_cf0027000385981 GS3 A AACTCTGACATCAGCCCGCAGACAGTCTGG ACAGTGGGAGGAAGAGGCGATGTGTCTCCC 2014-07-19 2014-07-19
snp_cf0002000332446 CID1 A AACTCTGACATCAGCCCGCAGACAGTCTGG ACAGTGGGAGGAAGAGGCGATGTGTCTCCC 2014-08-02 2014-08-02
snp_cf0026000389352 GS2 A AACTCTGACATCAGCCCGCAGACAGTCTGG ACAGTGGGAGGAAGAGGCGATGTGTCTCCC 2014-07-19 2014-07-19
snp_cf0029000337254 GS5 R AACTCTGACATCAGCCCGCAGACAGTCTGG ACAGTGGGAGGAAGAGGCGATGTGTCTCCC 2014-07-19 2014-07-19
snp_cf0010000504497 DQ2 R AACTCTGACATCAGCCCGCAGACAGTCTGG ACAGTGGGAGGAAGAGGCGATGTGTCTCCC 2014-07-19 2014-07-19
snp_cf0052000492333 LJ7 R AACTCTGACATCAGCCCGCAGACAGTCTGG ACAGTGGGAGGAAGAGGCGATGTGTCTCCC 2014-07-19 2014-07-19
snp_cf0034000616835 ISW A AACTCTGACATCAGCCCGCAGACAGTCTGG ACAGTGGGAGGAAGAGGCGATGTGTCTCCC 2014-07-19 2014-07-19
snp_cf0016000508933 DQ8 R AACTCTGACATCAGCCCGCAGACAGTCTGG ACAGTGGGAGGAAGAGGCGATGTGTCTCCC 2014-07-19 2014-07-19
snp_cf0055000646608 LUPWCHN00001 R AACTCTGACATCAGCCCGCAGACAGTCTGG ACAGTGGGAGGAAGAGGCGATGTGTCTCCC 2014-07-19 2014-07-19
snp_cf0071000519197 YJ2 A AACTCTGACATCAGCCCGCAGACAGTCTGG ACAGTGGGAGGAAGAGGCGATGTGTCTCCC 2014-07-19 2014-07-19
snp_cf0045000438343 LJ10 R AACTCTGACATCAGCCCGCAGACAGTCTGG ACAGTGGGAGGAAGAGGCGATGTGTCTCCC 2014-07-19 2014-07-19
snp_cf0063000506356 TM4 R AACTCTGACATCAGCCCGCAGACAGTCTGG ACAGTGGGAGGAAGAGGCGATGTGTCTCCC 2014-07-19 2014-07-19
snp_cf0070000534600 YJ1 R AACTCTGACATCAGCCCGCAGACAGTCTGG ACAGTGGGAGGAAGAGGCGATGTGTCTCCC 2014-07-19 2014-07-19
snp_cf0051000505656 LJ6 A AACTCTGACATCAGCCCGCAGACAGTCTGG ACAGTGGGAGGAAGAGGCGATGTGTCTCCC 2014-07-19 2014-07-19
snp_cf0021000482011 FAMICHN00001 R AACTCTGACATCAGCCCGCAGACAGTCTGG ACAGTGGGAGGAAGAGGCGATGTGTCTCCC 2014-07-19 2014-07-19
snp_cf0065000482436 TM6 A AACTCTGACATCAGCCCGCAGACAGTCTGG ACAGTGGGAGGAAGAGGCGATGTGTCTCCC 2014-07-19 2014-07-19
6.Fasta Information
TTTTGGCTTT CAGAAGGAGC AACTCTGACA TCAGCCCGCA GACAGTCTGG
A
ACAGTGGGAG GAAGAGGCGA TGTGTCTCCC TGTTGAAAAA GAGAAAAAGA