e.g. 1:1246..9423
SNP Detail For snp_cf0019000385879    [See in GBrowse]
1.General Information
SNP ID: snp_cf0019000385879
Organism: Canis familiaris
Individual: FAMBGSD00001
Create time: 2014-07-19
Last update: 2014-07-19
2.Allele Information
Platform: SOLEXA
Method: sequence
SNP Class: snp
Genotype: Y
5'flank: GCAAAATCCAGTGTGGCCTTGGCTCCAGCC
3'flank: TAGTGGAAACGTACAGTCGTTTATTGGTCT
3.Reference Map information
Chrom Position Reference FAMBGSD00001
Chr12 220157 C Y
4.Gene information
Gene model(s)
Gene ID Position in Gene Strands Gene Allele Location
ENSCAFG00000000380 25380 + C CDS
Transcript Protein
SNP to transcript Accession Position in Transcript Allele change Accession Position in Protein Residue change
+ ENSCAFT00000000597 1696 CTA => TTA ENSCAFP00000000544 566 L => L
5.SNPs of other individuals in this position
SNP_ID Individual Genotype 5' Near Seq 30 bp 3' Near Seq 30 bp Create time Last update time
NA NA NA NA NA NA NA
6.Fasta Information
GAGTGATAAA ACTTGCTCAT GCAAAATCCA GTGTGGCCTT GGCTCCAGCC
Y
TAGTGGAAAC GTACAGTCGT TTATTGGTCT ATATGGAAAT AGAGTCTTTG