e.g. 1:1246..9423
SNP Detail For snp_cf0019000386322    [See in GBrowse]
1.General Information
SNP ID: snp_cf0019000386322
Organism: Canis familiaris
Individual: FAMBGSD00001
Create time: 2014-07-19
Last update: 2014-07-19
2.Allele Information
Platform: SOLEXA
Method: sequence
SNP Class: snp
Genotype: R
5'flank: AGAAAAACATCCTCCTAAACCTGCCAAGCT
3'flank: GAGAAGAATCGGATCAATAAGGTGAAAGTG
3.Reference Map information
Chrom Position Reference FAMBGSD00001
Chr12 402046 G R
4.Gene information
Gene model(s)
Gene ID Position in Gene Strands Gene Allele Location
ENSCAFG00000030478 5006 + G CDS
Transcript Protein
SNP to transcript Accession Position in Transcript Allele change Accession Position in Protein Residue change
+ ENSCAFT00000000632 465 CTG => CTA ENSCAFP00000000577 155 L => L
+ ENSCAFT00000046193 303 CTG => CTA ENSCAFP00000037983 101 L => L
5.SNPs of other individuals in this position
SNP_ID Individual Genotype 5' Near Seq 30 bp 3' Near Seq 30 bp Create time Last update time
snp_cf0048000482205 LJ3 R AGAAAAACATCCTCCTAAACCTGCCAAGCT GAGAAGAATCGGATCAATAAGGTGAAAGTG 2014-07-19 2014-07-19
snp_cf0037000412113 KM2 A AGAAAAACATCCTCCTAAACCTGCCAAGCT GAGAAGAATCGGATCAATAAGGTGAAAGTG 2014-07-19 2014-07-19
snp_cf0053000493004 LJ8 R AGAAAAACATCCTCCTAAACCTGCCAAGCT GAGAAGAATCGGATCAATAAGGTGAAAGTG 2014-07-19 2014-07-19
snp_cf0046000454626 LJ1 R AGAAAAACATCCTCCTAAACCTGCCAAGCT GAGAAGAATCGGATCAATAAGGTGAAAGTG 2014-07-19 2014-07-19
snp_cf0056000652250 LUPWRUS00001 R AGAAAAACATCCTCCTAAACCTGCCAAGCT GAGAAGAATCGGATCAATAAGGTGAAAGTG 2014-07-19 2014-07-19
snp_cf0008000502019 DQ10 R AGAAAAACATCCTCCTAAACCTGCCAAGCT GAGAAGAATCGGATCAATAAGGTGAAAGTG 2014-07-19 2014-07-19
snp_cf0024000419493 GS10 R AGAAAAACATCCTCCTAAACCTGCCAAGCT GAGAAGAATCGGATCAATAAGGTGAAAGTG 2014-07-19 2014-07-19
snp_cf0038000404766 KM3 R AGAAAAACATCCTCCTAAACCTGCCAAGCT GAGAAGAATCGGATCAATAAGGTGAAAGTG 2014-07-19 2014-07-19
snp_cf0027000386709 GS3 R AGAAAAACATCCTCCTAAACCTGCCAAGCT GAGAAGAATCGGATCAATAAGGTGAAAGTG 2014-07-19 2014-07-19
snp_cf0040000440766 KM5 A AGAAAAACATCCTCCTAAACCTGCCAAGCT GAGAAGAATCGGATCAATAAGGTGAAAGTG 2014-07-19 2014-07-19
snp_cf0067000502901 TM8 R AGAAAAACATCCTCCTAAACCTGCCAAGCT GAGAAGAATCGGATCAATAAGGTGAAAGTG 2014-07-19 2014-07-19
snp_cf0068000494557 TM9 A AGAAAAACATCCTCCTAAACCTGCCAAGCT GAGAAGAATCGGATCAATAAGGTGAAAGTG 2014-07-19 2014-07-19
snp_cf0063000506934 TM4 R AGAAAAACATCCTCCTAAACCTGCCAAGCT GAGAAGAATCGGATCAATAAGGTGAAAGTG 2014-07-19 2014-07-19
snp_cf0045000438791 LJ10 R AGAAAAACATCCTCCTAAACCTGCCAAGCT GAGAAGAATCGGATCAATAAGGTGAAAGTG 2014-07-19 2014-07-19
snp_cf0020000500308 FAMBTIM00001 R AGAAAAACATCCTCCTAAACCTGCCAAGCT GAGAAGAATCGGATCAATAAGGTGAAAGTG 2014-07-19 2014-07-19
snp_cf0049000520896 LJ4 R AGAAAAACATCCTCCTAAACCTGCCAAGCT GAGAAGAATCGGATCAATAAGGTGAAAGTG 2014-07-19 2014-07-19
snp_cf0012000504256 DQ4 R AGAAAAACATCCTCCTAAACCTGCCAAGCT GAGAAGAATCGGATCAATAAGGTGAAAGTG 2014-07-19 2014-07-19
snp_cf0047000477457 LJ2 R AGAAAAACATCCTCCTAAACCTGCCAAGCT GAGAAGAATCGGATCAATAAGGTGAAAGTG 2014-07-19 2014-07-19
snp_cf0074000516310 YJ5 R AGAAAAACATCCTCCTAAACCTGCCAAGCT GAGAAGAATCGGATCAATAAGGTGAAAGTG 2014-07-19 2014-07-19
snp_cf0041000482937 KM6 R AGAAAAACATCCTCCTAAACCTGCCAAGCT GAGAAGAATCGGATCAATAAGGTGAAAGTG 2014-07-19 2014-07-19
snp_cf0033000406144 GS9 R AGAAAAACATCCTCCTAAACCTGCCAAGCT GAGAAGAATCGGATCAATAAGGTGAAAGTG 2014-07-19 2014-07-19
snp_cf0032000383078 GS8 A AGAAAAACATCCTCCTAAACCTGCCAAGCT GAGAAGAATCGGATCAATAAGGTGAAAGTG 2014-07-19 2014-07-19
snp_cf0073000514543 YJ4 R AGAAAAACATCCTCCTAAACCTGCCAAGCT GAGAAGAATCGGATCAATAAGGTGAAAGTG 2014-07-19 2014-07-19
snp_cf0039000402326 KM4 A AGAAAAACATCCTCCTAAACCTGCCAAGCT GAGAAGAATCGGATCAATAAGGTGAAAGTG 2014-07-19 2014-07-19
snp_cf0060000521681 TM1 R AGAAAAACATCCTCCTAAACCTGCCAAGCT GAGAAGAATCGGATCAATAAGGTGAAAGTG 2014-07-19 2014-07-19
snp_cf0036000396757 KM1 A AGAAAAACATCCTCCTAAACCTGCCAAGCT GAGAAGAATCGGATCAATAAGGTGAAAGTG 2014-07-19 2014-07-19
snp_cf0042000497334 KM7 R AGAAAAACATCCTCCTAAACCTGCCAAGCT GAGAAGAATCGGATCAATAAGGTGAAAGTG 2014-07-19 2014-07-19
snp_cf0061000515135 TM2 R AGAAAAACATCCTCCTAAACCTGCCAAGCT GAGAAGAATCGGATCAATAAGGTGAAAGTG 2014-07-19 2014-07-19
snp_cf0065000482912 TM6 A AGAAAAACATCCTCCTAAACCTGCCAAGCT GAGAAGAATCGGATCAATAAGGTGAAAGTG 2014-07-19 2014-07-19
snp_cf0051000506131 LJ6 A AGAAAAACATCCTCCTAAACCTGCCAAGCT GAGAAGAATCGGATCAATAAGGTGAAAGTG 2014-07-19 2014-07-19
snp_cf0025000371778 GS1 R AGAAAAACATCCTCCTAAACCTGCCAAGCT GAGAAGAATCGGATCAATAAGGTGAAAGTG 2014-07-19 2014-07-19
snp_cf0023000476405 FAMICHN00003 R AGAAAAACATCCTCCTAAACCTGCCAAGCT GAGAAGAATCGGATCAATAAGGTGAAAGTG 2014-07-19 2014-07-19
snp_cf0059000515893 TM10 A AGAAAAACATCCTCCTAAACCTGCCAAGCT GAGAAGAATCGGATCAATAAGGTGAAAGTG 2014-07-19 2014-07-19
snp_cf0013000501717 DQ5 R AGAAAAACATCCTCCTAAACCTGCCAAGCT GAGAAGAATCGGATCAATAAGGTGAAAGTG 2014-07-19 2014-07-19
snp_cf0055000647167 LUPWCHN00001 R AGAAAAACATCCTCCTAAACCTGCCAAGCT GAGAAGAATCGGATCAATAAGGTGAAAGTG 2014-07-19 2014-07-19
snp_cf0026000389821 GS2 A AGAAAAACATCCTCCTAAACCTGCCAAGCT GAGAAGAATCGGATCAATAAGGTGAAAGTG 2014-07-19 2014-07-19
6.Fasta Information
AGTGAGGATG AGGAGGAAGA AGAAAAACAT CCTCCTAAAC CTGCCAAGCT
R
GAGAAGAATC GGATCAATAA GGTGAAAGTG GCAGCCCTGC TGGTCACTCC