e.g. 1:1246..9423
SNP Detail For snp_cf0019000386358    [See in GBrowse]
1.General Information
SNP ID: snp_cf0019000386358
Organism: Canis familiaris
Individual: FAMBGSD00001
Create time: 2014-07-19
Last update: 2014-07-19
NCBI rs link rs8842166  
2.Allele Information
Platform: SOLEXA
Method: sequence
SNP Class: snp
Genotype: Y
5'flank: CCCAAACCTGAACCAATTTCTAGACTTACC
3'flank: GTATCCATGAGCTCTGGGACTTCAACAGGG
3.Reference Map information
Chrom Position Reference FAMBGSD00001
Chr12 420732 T Y
4.Gene information
Gene model(s)
Gene ID Position in Gene Strands Gene Allele Location
ENSCAFG00000000406 7079 - T CDS
Transcript Protein
SNP to transcript Accession Position in Transcript Allele change Accession Position in Protein Residue change
- ENSCAFT00000048295 1101 ACA => ACG ENSCAFP00000039379 367 T => T
- ENSCAFT00000000645 1101 ACA => ACG ENSCAFP00000000590 367 T => T
5.SNPs of other individuals in this position
SNP_ID Individual Genotype 5' Near Seq 30 bp 3' Near Seq 30 bp Create time Last update time
snp_cf0050000457746 LJ5 Y CCCAAACCTGAACCAATTTCTAGACTTACC GTATCCATGAGCTCTGGGACTTCAACAGGG 2014-07-19 2014-07-19
snp_cf0011000511618 DQ3 Y CCCAAACCTGAACCAATTTCTAGACTTACC GTATCCATGAGCTCTGGGACTTCAACAGGG 2014-07-19 2014-07-19
snp_cf0031000390162 GS7 Y CCCAAACCTGAACCAATTTCTAGACTTACC GTATCCATGAGCTCTGGGACTTCAACAGGG 2014-07-19 2014-07-19
snp_cf0052000493032 LJ7 Y CCCAAACCTGAACCAATTTCTAGACTTACC GTATCCATGAGCTCTGGGACTTCAACAGGG 2014-07-19 2014-07-19
snp_cf0034000617367 ISW C CCCAAACCTGAACCAATTTCTAGACTTACC GTATCCATGAGCTCTGGGACTTCAACAGGG 2014-07-19 2014-07-19
snp_cf0016000509455 DQ8 Y CCCAAACCTGAACCAATTTCTAGACTTACC GTATCCATGAGCTCTGGGACTTCAACAGGG 2014-07-19 2014-07-19
snp_cf0021000482495 FAMICHN00001 Y CCCAAACCTGAACCAATTTCTAGACTTACC GTATCCATGAGCTCTGGGACTTCAACAGGG 2014-07-19 2014-07-19
snp_cf0003000275989 dbSNP139 C CCCAAACCTGAACCAATTTCTAGACTTACC GTATCCATGAGCTCTGGGACTTCAACAGGG 2014-07-19 2014-07-19
snp_cf0027000386748 GS3 Y CCCAAACCTGAACCAATTTCTAGACTTACC GTATCCATGAGCTCTGGGACTTCAACAGGG 2014-07-19 2014-07-19
snp_cf0004000420940 Basenji Y CCCAAACCTGAACCAATTTCTAGACTTACC GTATCCATGAGCTCTGGGACTTCAACAGGG 2014-07-19 2014-07-19
snp_cf0058000642156 LUPWRUS00003 Y CCCAAACCTGAACCAATTTCTAGACTTACC GTATCCATGAGCTCTGGGACTTCAACAGGG 2014-07-19 2014-07-19
6.Fasta Information
GTCGTTCCTT TTAGAAACCC CCCAAACCTG AACCAATTTC TAGACTTACC
Y
GTATCCATGA GCTCTGGGAC TTCAACAGGG GGAACTGGGG TTCCTGGGCG