e.g. 1:1246..9423
SNP Detail For snp_cf0019000807287    [See in GBrowse]
1.General Information
SNP ID: snp_cf0019000807287
Organism: Canis familiaris
Individual: FAMBGSD00001
Create time: 2014-07-19
Last update: 2014-07-19
NCBI rs link rs9013644  
2.Allele Information
Platform: SOLEXA
Method: sequence
SNP Class: snp
Genotype: T
5'flank: CCCTGCGCCCTCGCTCCCCGCAGGGGTCAG
3'flank: GCCATGATCGCCAAGCTGGCCAAGACCTGC
3.Reference Map information
Chrom Position Reference FAMBGSD00001
Chr16 94267 C T
4.Gene information
Gene model(s)
Gene ID Position in Gene Strands Gene Allele Location
ENSCAFG00000031089 102 - C CDS
ENSCAFG00000025598 555 + C CDS
Transcript Protein
SNP to transcript Accession Position in Transcript Allele change Accession Position in Protein Residue change
- ENSCAFT00000048823 102 GCG => GCA ENSCAFP00000041015 34 A => A
+ ENSCAFT00000039863 60 AGC => AGT ENSCAFP00000035775 20 S => S
5.SNPs of other individuals in this position
SNP_ID Individual Genotype 5' Near Seq 30 bp 3' Near Seq 30 bp Create time Last update time
snp_cf0030000829743 GS6 T CCCTGCGCCCTCGCTCCCCGCAGGGGTCAG GCCATGATCGCCAAGCTGGCCAAGACCTGC 2014-07-19 2014-07-19
snp_cf0065001013932 TM6 T CCCTGCGCCCTCGCTCCCCGCAGGGGTCAG GCCATGATCGCCAAGCTGGCCAAGACCTGC 2014-07-19 2014-07-19
snp_cf0048000994889 LJ3 T CCCTGCGCCCTCGCTCCCCGCAGGGGTCAG GCCATGATCGCCAAGCTGGCCAAGACCTGC 2014-07-19 2014-07-19
snp_cf0031000820107 GS7 Y CCCTGCGCCCTCGCTCCCCGCAGGGGTCAG GCCATGATCGCCAAGCTGGCCAAGACCTGC 2014-07-19 2014-07-19
snp_cf0063001027915 TM4 T CCCTGCGCCCTCGCTCCCCGCAGGGGTCAG GCCATGATCGCCAAGCTGGCCAAGACCTGC 2014-07-19 2014-07-19
snp_cf0010001043067 DQ2 Y CCCTGCGCCCTCGCTCCCCGCAGGGGTCAG GCCATGATCGCCAAGCTGGCCAAGACCTGC 2014-07-19 2014-07-19
snp_cf0075001070534 YJ6 T CCCTGCGCCCTCGCTCCCCGCAGGGGTCAG GCCATGATCGCCAAGCTGGCCAAGACCTGC 2014-07-19 2014-07-19
snp_cf0059001051734 TM10 T CCCTGCGCCCTCGCTCCCCGCAGGGGTCAG GCCATGATCGCCAAGCTGGCCAAGACCTGC 2014-07-19 2014-07-19
snp_cf0002000678092 CID1 T CCCTGCGCCCTCGCTCCCCGCAGGGGTCAG GCCATGATCGCCAAGCTGGCCAAGACCTGC 2014-08-02 2014-08-02
snp_cf0061001055595 TM2 T CCCTGCGCCCTCGCTCCCCGCAGGGGTCAG GCCATGATCGCCAAGCTGGCCAAGACCTGC 2014-07-19 2014-07-19
snp_cf0013001008459 DQ5 T CCCTGCGCCCTCGCTCCCCGCAGGGGTCAG GCCATGATCGCCAAGCTGGCCAAGACCTGC 2014-07-19 2014-07-19
snp_cf0067001009143 TM8 T CCCTGCGCCCTCGCTCCCCGCAGGGGTCAG GCCATGATCGCCAAGCTGGCCAAGACCTGC 2014-07-19 2014-07-19
snp_cf0078001065188 YJ9 T CCCTGCGCCCTCGCTCCCCGCAGGGGTCAG GCCATGATCGCCAAGCTGGCCAAGACCTGC 2014-07-19 2014-07-19
snp_cf0071001064844 YJ2 T CCCTGCGCCCTCGCTCCCCGCAGGGGTCAG GCCATGATCGCCAAGCTGGCCAAGACCTGC 2014-07-19 2014-07-19
snp_cf0060001035651 TM1 T CCCTGCGCCCTCGCTCCCCGCAGGGGTCAG GCCATGATCGCCAAGCTGGCCAAGACCTGC 2014-07-19 2014-07-19
snp_cf0008001032853 DQ10 Y CCCTGCGCCCTCGCTCCCCGCAGGGGTCAG GCCATGATCGCCAAGCTGGCCAAGACCTGC 2014-07-19 2014-07-19
snp_cf0015001045461 DQ7 Y CCCTGCGCCCTCGCTCCCCGCAGGGGTCAG GCCATGATCGCCAAGCTGGCCAAGACCTGC 2014-07-19 2014-07-19
snp_cf0028000767937 GS4 Y CCCTGCGCCCTCGCTCCCCGCAGGGGTCAG GCCATGATCGCCAAGCTGGCCAAGACCTGC 2014-07-19 2014-07-19
snp_cf0011001055534 DQ3 T CCCTGCGCCCTCGCTCCCCGCAGGGGTCAG GCCATGATCGCCAAGCTGGCCAAGACCTGC 2014-07-19 2014-07-19
snp_cf0024000845685 GS10 Y CCCTGCGCCCTCGCTCCCCGCAGGGGTCAG GCCATGATCGCCAAGCTGGCCAAGACCTGC 2014-07-19 2014-07-19
snp_cf0057001260741 LUPWRUS00002 Y CCCTGCGCCCTCGCTCCCCGCAGGGGTCAG GCCATGATCGCCAAGCTGGCCAAGACCTGC 2014-07-19 2014-07-19
snp_cf0069001075967 YJ10 T CCCTGCGCCCTCGCTCCCCGCAGGGGTCAG GCCATGATCGCCAAGCTGGCCAAGACCTGC 2014-07-19 2014-07-19
snp_cf0018000867809 FAMBBEM00001 Y CCCTGCGCCCTCGCTCCCCGCAGGGGTCAG GCCATGATCGCCAAGCTGGCCAAGACCTGC 2014-07-19 2014-07-19
snp_cf0032000801276 GS8 Y CCCTGCGCCCTCGCTCCCCGCAGGGGTCAG GCCATGATCGCCAAGCTGGCCAAGACCTGC 2014-07-19 2014-07-19
snp_cf0073001057221 YJ4 T CCCTGCGCCCTCGCTCCCCGCAGGGGTCAG GCCATGATCGCCAAGCTGGCCAAGACCTGC 2014-07-19 2014-07-19
snp_cf0041001036800 KM6 Y CCCTGCGCCCTCGCTCCCCGCAGGGGTCAG GCCATGATCGCCAAGCTGGCCAAGACCTGC 2014-07-19 2014-07-19
snp_cf0034001231935 ISW T CCCTGCGCCCTCGCTCCCCGCAGGGGTCAG GCCATGATCGCCAAGCTGGCCAAGACCTGC 2014-07-19 2014-07-19
snp_cf0035001011243 KM10 T CCCTGCGCCCTCGCTCCCCGCAGGGGTCAG GCCATGATCGCCAAGCTGGCCAAGACCTGC 2014-07-19 2014-07-19
snp_cf0043000867739 KM8 Y CCCTGCGCCCTCGCTCCCCGCAGGGGTCAG GCCATGATCGCCAAGCTGGCCAAGACCTGC 2014-07-19 2014-07-19
snp_cf0025000802951 GS1 T CCCTGCGCCCTCGCTCCCCGCAGGGGTCAG GCCATGATCGCCAAGCTGGCCAAGACCTGC 2014-07-19 2014-07-19
snp_cf0016001038417 DQ8 Y CCCTGCGCCCTCGCTCCCCGCAGGGGTCAG GCCATGATCGCCAAGCTGGCCAAGACCTGC 2014-07-19 2014-07-19
snp_cf0004000866187 Basenji Y CCCTGCGCCCTCGCTCCCCGCAGGGGTCAG GCCATGATCGCCAAGCTGGCCAAGACCTGC 2014-07-19 2014-07-19
snp_cf0064001051460 TM5 T CCCTGCGCCCTCGCTCCCCGCAGGGGTCAG GCCATGATCGCCAAGCTGGCCAAGACCTGC 2014-07-19 2014-07-19
snp_cf0014001026429 DQ6 Y CCCTGCGCCCTCGCTCCCCGCAGGGGTCAG GCCATGATCGCCAAGCTGGCCAAGACCTGC 2014-07-19 2014-07-19
snp_cf0029000749276 GS5 Y CCCTGCGCCCTCGCTCCCCGCAGGGGTCAG GCCATGATCGCCAAGCTGGCCAAGACCTGC 2014-07-19 2014-07-19
snp_cf0020001032160 FAMBTIM00001 Y CCCTGCGCCCTCGCTCCCCGCAGGGGTCAG GCCATGATCGCCAAGCTGGCCAAGACCTGC 2014-07-19 2014-07-19
snp_cf0074001060341 YJ5 T CCCTGCGCCCTCGCTCCCCGCAGGGGTCAG GCCATGATCGCCAAGCTGGCCAAGACCTGC 2014-07-19 2014-07-19
snp_cf0026000806356 GS2 Y CCCTGCGCCCTCGCTCCCCGCAGGGGTCAG GCCATGATCGCCAAGCTGGCCAAGACCTGC 2014-07-19 2014-07-19
snp_cf0038000798643 KM3 Y CCCTGCGCCCTCGCTCCCCGCAGGGGTCAG GCCATGATCGCCAAGCTGGCCAAGACCTGC 2014-07-19 2014-07-19
snp_cf0068001005177 TM9 T CCCTGCGCCCTCGCTCCCCGCAGGGGTCAG GCCATGATCGCCAAGCTGGCCAAGACCTGC 2014-07-19 2014-07-19
snp_cf0009001051731 DQ1 Y CCCTGCGCCCTCGCTCCCCGCAGGGGTCAG GCCATGATCGCCAAGCTGGCCAAGACCTGC 2014-07-19 2014-07-19
snp_cf0062001045263 TM3 T CCCTGCGCCCTCGCTCCCCGCAGGGGTCAG GCCATGATCGCCAAGCTGGCCAAGACCTGC 2014-07-19 2014-07-19
snp_cf0003000583628 dbSNP139 T CCCTGCGCCCTCGCTCCCCGCAGGGGTCAG GCCATGATCGCCAAGCTGGCCAAGACCTGC 2014-07-19 2014-07-19
snp_cf0066001064399 TM7 T CCCTGCGCCCTCGCTCCCCGCAGGGGTCAG GCCATGATCGCCAAGCTGGCCAAGACCTGC 2014-07-19 2014-07-19
snp_cf0077001053363 YJ8 Y CCCTGCGCCCTCGCTCCCCGCAGGGGTCAG GCCATGATCGCCAAGCTGGCCAAGACCTGC 2014-07-19 2014-07-19
snp_cf0058001306822 LUPWRUS00003 Y CCCTGCGCCCTCGCTCCCCGCAGGGGTCAG GCCATGATCGCCAAGCTGGCCAAGACCTGC 2014-07-19 2014-07-19
snp_cf0052001017592 LJ7 T CCCTGCGCCCTCGCTCCCCGCAGGGGTCAG GCCATGATCGCCAAGCTGGCCAAGACCTGC 2014-07-19 2014-07-19
snp_cf0017001057734 DQ9 Y CCCTGCGCCCTCGCTCCCCGCAGGGGTCAG GCCATGATCGCCAAGCTGGCCAAGACCTGC 2014-07-19 2014-07-19
snp_cf0007000883710 Dingo T CCCTGCGCCCTCGCTCCCCGCAGGGGTCAG GCCATGATCGCCAAGCTGGCCAAGACCTGC 2014-07-19 2014-07-19
snp_cf0047001007320 LJ2 T CCCTGCGCCCTCGCTCCCCGCAGGGGTCAG GCCATGATCGCCAAGCTGGCCAAGACCTGC 2014-07-19 2014-07-19
snp_cf0042001073351 KM7 Y CCCTGCGCCCTCGCTCCCCGCAGGGGTCAG GCCATGATCGCCAAGCTGGCCAAGACCTGC 2014-07-19 2014-07-19
snp_cf0044000923087 KM9 Y CCCTGCGCCCTCGCTCCCCGCAGGGGTCAG GCCATGATCGCCAAGCTGGCCAAGACCTGC 2014-07-19 2014-07-19
snp_cf0023000991990 FAMICHN00003 T CCCTGCGCCCTCGCTCCCCGCAGGGGTCAG GCCATGATCGCCAAGCTGGCCAAGACCTGC 2014-07-19 2014-07-19
snp_cf0076001075798 YJ7 T CCCTGCGCCCTCGCTCCCCGCAGGGGTCAG GCCATGATCGCCAAGCTGGCCAAGACCTGC 2014-07-19 2014-07-19
snp_cf0036000825154 KM1 Y CCCTGCGCCCTCGCTCCCCGCAGGGGTCAG GCCATGATCGCCAAGCTGGCCAAGACCTGC 2014-07-19 2014-07-19
snp_cf0021000986511 FAMICHN00001 Y CCCTGCGCCCTCGCTCCCCGCAGGGGTCAG GCCATGATCGCCAAGCTGGCCAAGACCTGC 2014-07-19 2014-07-19
snp_cf0001000434512 solidGW1 T CCCTGCGCCCTCGCTCCCCGCAGGGGTCAG GCCATGATCGCCAAGCTGGCCAAGACCTGC 2014-08-01 2014-08-01
snp_cf0072001071440 YJ3 T CCCTGCGCCCTCGCTCCCCGCAGGGGTCAG GCCATGATCGCCAAGCTGGCCAAGACCTGC 2014-07-19 2014-07-19
snp_cf0012001047706 DQ4 T CCCTGCGCCCTCGCTCCCCGCAGGGGTCAG GCCATGATCGCCAAGCTGGCCAAGACCTGC 2014-07-19 2014-07-19
snp_cf0039000836141 KM4 Y CCCTGCGCCCTCGCTCCCCGCAGGGGTCAG GCCATGATCGCCAAGCTGGCCAAGACCTGC 2014-07-19 2014-07-19
snp_cf0005001279899 CHW T CCCTGCGCCCTCGCTCCCCGCAGGGGTCAG GCCATGATCGCCAAGCTGGCCAAGACCTGC 2014-07-19 2014-07-19
snp_cf0055001308715 LUPWCHN00001 T CCCTGCGCCCTCGCTCCCCGCAGGGGTCAG GCCATGATCGCCAAGCTGGCCAAGACCTGC 2014-07-19 2014-07-19
snp_cf0037000884239 KM2 Y CCCTGCGCCCTCGCTCCCCGCAGGGGTCAG GCCATGATCGCCAAGCTGGCCAAGACCTGC 2014-07-19 2014-07-19
snp_cf0051001043417 LJ6 T CCCTGCGCCCTCGCTCCCCGCAGGGGTCAG GCCATGATCGCCAAGCTGGCCAAGACCTGC 2014-07-19 2014-07-19
snp_cf0056001322817 LUPWRUS00001 Y CCCTGCGCCCTCGCTCCCCGCAGGGGTCAG GCCATGATCGCCAAGCTGGCCAAGACCTGC 2014-07-19 2014-07-19
snp_cf0070001099183 YJ1 Y CCCTGCGCCCTCGCTCCCCGCAGGGGTCAG GCCATGATCGCCAAGCTGGCCAAGACCTGC 2014-07-19 2014-07-19
snp_cf0033000811179 GS9 Y CCCTGCGCCCTCGCTCCCCGCAGGGGTCAG GCCATGATCGCCAAGCTGGCCAAGACCTGC 2014-07-19 2014-07-19
snp_cf0027000808090 GS3 T CCCTGCGCCCTCGCTCCCCGCAGGGGTCAG GCCATGATCGCCAAGCTGGCCAAGACCTGC 2014-07-19 2014-07-19
snp_cf0040000920815 KM5 Y CCCTGCGCCCTCGCTCCCCGCAGGGGTCAG GCCATGATCGCCAAGCTGGCCAAGACCTGC 2014-07-19 2014-07-19
snp_cf0049001050331 LJ4 Y CCCTGCGCCCTCGCTCCCCGCAGGGGTCAG GCCATGATCGCCAAGCTGGCCAAGACCTGC 2014-07-19 2014-07-19
6.Fasta Information
CCAGCCTCCT GAAGCAGCTG CCCTGCGCCC TCGCTCCCCG CAGGGGTCAG
T
GCCATGATCG CCAAGCTGGC CAAGACCTGC ACGCTGCGCA TCAGCCCGGA