e.g. 1:1246..9423
SNP Detail For snp_cf0019000807289    [See in GBrowse]
1.General Information
SNP ID: snp_cf0019000807289
Organism: Canis familiaris
Individual: FAMBGSD00001
Create time: 2014-07-19
Last update: 2014-07-19
NCBI rs link rs9013642  
2.Allele Information
Platform: SOLEXA
Method: sequence
SNP Class: snp
Genotype: R
5'flank: TAATAAGCACTTTCCCTGCCTCACGGTCTC
3'flank: ATAGAGCTGGTGAGTGGGGGGCAGCGCCGA
3.Reference Map information
Chrom Position Reference FAMBGSD00001
Chr16 94637 G R
4.Gene information
Gene model(s)
Gene ID Position in Gene Strands Gene Allele Location
ENSCAFG00000025598 925 + G CDS
Transcript Protein
SNP to transcript Accession Position in Transcript Allele change Accession Position in Protein Residue change
+ ENSCAFT00000039863 348 TCG => TCA ENSCAFP00000035775 116 S => S
5.SNPs of other individuals in this position
SNP_ID Individual Genotype 5' Near Seq 30 bp 3' Near Seq 30 bp Create time Last update time
snp_cf0030000829745 GS6 R TAATAAGCACTTTCCCTGCCTCACGGTCTC ATAGAGCTGGTGAGTGGGGGGCAGCGCCGA 2014-07-19 2014-07-19
snp_cf0020001032162 FAMBTIM00001 R TAATAAGCACTTTCCCTGCCTCACGGTCTC ATAGAGCTGGTGAGTGGGGGGCAGCGCCGA 2014-07-19 2014-07-19
snp_cf0026000806358 GS2 R TAATAAGCACTTTCCCTGCCTCACGGTCTC ATAGAGCTGGTGAGTGGGGGGCAGCGCCGA 2014-07-19 2014-07-19
snp_cf0074001060343 YJ5 R TAATAAGCACTTTCCCTGCCTCACGGTCTC ATAGAGCTGGTGAGTGGGGGGCAGCGCCGA 2014-07-19 2014-07-19
snp_cf0029000749279 GS5 R TAATAAGCACTTTCCCTGCCTCACGGTCTC ATAGAGCTGGTGAGTGGGGGGCAGCGCCGA 2014-07-19 2014-07-19
snp_cf0031000820109 GS7 R TAATAAGCACTTTCCCTGCCTCACGGTCTC ATAGAGCTGGTGAGTGGGGGGCAGCGCCGA 2014-07-19 2014-07-19
snp_cf0002000678093 CID1 R TAATAAGCACTTTCCCTGCCTCACGGTCTC ATAGAGCTGGTGAGTGGGGGGCAGCGCCGA 2014-08-02 2014-08-02
snp_cf0075001070536 YJ6 R TAATAAGCACTTTCCCTGCCTCACGGTCTC ATAGAGCTGGTGAGTGGGGGGCAGCGCCGA 2014-07-19 2014-07-19
snp_cf0038000798645 KM3 R TAATAAGCACTTTCCCTGCCTCACGGTCTC ATAGAGCTGGTGAGTGGGGGGCAGCGCCGA 2014-07-19 2014-07-19
snp_cf0033000811182 GS9 R TAATAAGCACTTTCCCTGCCTCACGGTCTC ATAGAGCTGGTGAGTGGGGGGCAGCGCCGA 2014-07-19 2014-07-19
snp_cf0014001026432 DQ6 R TAATAAGCACTTTCCCTGCCTCACGGTCTC ATAGAGCTGGTGAGTGGGGGGCAGCGCCGA 2014-07-19 2014-07-19
snp_cf0061001055597 TM2 R TAATAAGCACTTTCCCTGCCTCACGGTCTC ATAGAGCTGGTGAGTGGGGGGCAGCGCCGA 2014-07-19 2014-07-19
snp_cf0063001027918 TM4 R TAATAAGCACTTTCCCTGCCTCACGGTCTC ATAGAGCTGGTGAGTGGGGGGCAGCGCCGA 2014-07-19 2014-07-19
snp_cf0048000994891 LJ3 R TAATAAGCACTTTCCCTGCCTCACGGTCTC ATAGAGCTGGTGAGTGGGGGGCAGCGCCGA 2014-07-19 2014-07-19
snp_cf0071001064846 YJ2 R TAATAAGCACTTTCCCTGCCTCACGGTCTC ATAGAGCTGGTGAGTGGGGGGCAGCGCCGA 2014-07-19 2014-07-19
snp_cf0017001057736 DQ9 R TAATAAGCACTTTCCCTGCCTCACGGTCTC ATAGAGCTGGTGAGTGGGGGGCAGCGCCGA 2014-07-19 2014-07-19
snp_cf0042001073353 KM7 R TAATAAGCACTTTCCCTGCCTCACGGTCTC ATAGAGCTGGTGAGTGGGGGGCAGCGCCGA 2014-07-19 2014-07-19
snp_cf0062001045265 TM3 R TAATAAGCACTTTCCCTGCCTCACGGTCTC ATAGAGCTGGTGAGTGGGGGGCAGCGCCGA 2014-07-19 2014-07-19
snp_cf0007000883712 Dingo R TAATAAGCACTTTCCCTGCCTCACGGTCTC ATAGAGCTGGTGAGTGGGGGGCAGCGCCGA 2014-07-19 2014-07-19
snp_cf0028000767939 GS4 R TAATAAGCACTTTCCCTGCCTCACGGTCTC ATAGAGCTGGTGAGTGGGGGGCAGCGCCGA 2014-07-19 2014-07-19
snp_cf0023000991992 FAMICHN00003 R TAATAAGCACTTTCCCTGCCTCACGGTCTC ATAGAGCTGGTGAGTGGGGGGCAGCGCCGA 2014-07-19 2014-07-19
snp_cf0036000825156 KM1 R TAATAAGCACTTTCCCTGCCTCACGGTCTC ATAGAGCTGGTGAGTGGGGGGCAGCGCCGA 2014-07-19 2014-07-19
snp_cf0018000867812 FAMBBEM00001 R TAATAAGCACTTTCCCTGCCTCACGGTCTC ATAGAGCTGGTGAGTGGGGGGCAGCGCCGA 2014-07-19 2014-07-19
snp_cf0024000845687 GS10 R TAATAAGCACTTTCCCTGCCTCACGGTCTC ATAGAGCTGGTGAGTGGGGGGCAGCGCCGA 2014-07-19 2014-07-19
snp_cf0043000867741 KM8 R TAATAAGCACTTTCCCTGCCTCACGGTCTC ATAGAGCTGGTGAGTGGGGGGCAGCGCCGA 2014-07-19 2014-07-19
snp_cf0037000884242 KM2 R TAATAAGCACTTTCCCTGCCTCACGGTCTC ATAGAGCTGGTGAGTGGGGGGCAGCGCCGA 2014-07-19 2014-07-19
snp_cf0021000986513 FAMICHN00001 R TAATAAGCACTTTCCCTGCCTCACGGTCTC ATAGAGCTGGTGAGTGGGGGGCAGCGCCGA 2014-07-19 2014-07-19
snp_cf0069001075969 YJ10 R TAATAAGCACTTTCCCTGCCTCACGGTCTC ATAGAGCTGGTGAGTGGGGGGCAGCGCCGA 2014-07-19 2014-07-19
snp_cf0039000836143 KM4 R TAATAAGCACTTTCCCTGCCTCACGGTCTC ATAGAGCTGGTGAGTGGGGGGCAGCGCCGA 2014-07-19 2014-07-19
snp_cf0032000801278 GS8 R TAATAAGCACTTTCCCTGCCTCACGGTCTC ATAGAGCTGGTGAGTGGGGGGCAGCGCCGA 2014-07-19 2014-07-19
snp_cf0051001043419 LJ6 R TAATAAGCACTTTCCCTGCCTCACGGTCTC ATAGAGCTGGTGAGTGGGGGGCAGCGCCGA 2014-07-19 2014-07-19
snp_cf0072001071442 YJ3 R TAATAAGCACTTTCCCTGCCTCACGGTCTC ATAGAGCTGGTGAGTGGGGGGCAGCGCCGA 2014-07-19 2014-07-19
snp_cf0053001016056 LJ8 R TAATAAGCACTTTCCCTGCCTCACGGTCTC ATAGAGCTGGTGAGTGGGGGGCAGCGCCGA 2014-07-19 2014-07-19
snp_cf0049001050334 LJ4 R TAATAAGCACTTTCCCTGCCTCACGGTCTC ATAGAGCTGGTGAGTGGGGGGCAGCGCCGA 2014-07-19 2014-07-19
snp_cf0066001064402 TM7 R TAATAAGCACTTTCCCTGCCTCACGGTCTC ATAGAGCTGGTGAGTGGGGGGCAGCGCCGA 2014-07-19 2014-07-19
snp_cf0041001036802 KM6 R TAATAAGCACTTTCCCTGCCTCACGGTCTC ATAGAGCTGGTGAGTGGGGGGCAGCGCCGA 2014-07-19 2014-07-19
snp_cf0046000965575 LJ1 R TAATAAGCACTTTCCCTGCCTCACGGTCTC ATAGAGCTGGTGAGTGGGGGGCAGCGCCGA 2014-07-19 2014-07-19
snp_cf0070001099185 YJ1 R TAATAAGCACTTTCCCTGCCTCACGGTCTC ATAGAGCTGGTGAGTGGGGGGCAGCGCCGA 2014-07-19 2014-07-19
snp_cf0025000802953 GS1 R TAATAAGCACTTTCCCTGCCTCACGGTCTC ATAGAGCTGGTGAGTGGGGGGCAGCGCCGA 2014-07-19 2014-07-19
snp_cf0027000808092 GS3 R TAATAAGCACTTTCCCTGCCTCACGGTCTC ATAGAGCTGGTGAGTGGGGGGCAGCGCCGA 2014-07-19 2014-07-19
snp_cf0003000583630 dbSNP139 A TAATAAGCACTTTCCCTGCCTCACGGTCTC ATAGAGCTGGTGAGTGGGGGGCAGCGCCGA 2014-07-19 2014-07-19
snp_cf0016001038419 DQ8 R TAATAAGCACTTTCCCTGCCTCACGGTCTC ATAGAGCTGGTGAGTGGGGGGCAGCGCCGA 2014-07-19 2014-07-19
snp_cf0040000920817 KM5 R TAATAAGCACTTTCCCTGCCTCACGGTCTC ATAGAGCTGGTGAGTGGGGGGCAGCGCCGA 2014-07-19 2014-07-19
snp_cf0064001051462 TM5 R TAATAAGCACTTTCCCTGCCTCACGGTCTC ATAGAGCTGGTGAGTGGGGGGCAGCGCCGA 2014-07-19 2014-07-19
6.Fasta Information
GCCTTGAAGA TCAAGCTGAC TAATAAGCAC TTTCCCTGCC TCACGGTCTC
R
ATAGAGCTGG TGAGTGGGGG GCAGCGCCGA GCCGGCCCCG GCCCGGTTAC