e.g. 1:1246..9423
SNP Detail For snp_cf0019001305489    [See in GBrowse]
1.General Information
SNP ID: snp_cf0019001305489
Organism: Canis familiaris
Individual: FAMBGSD00001
Create time: 2014-07-19
Last update: 2014-07-19
2.Allele Information
Platform: SOLEXA
Method: sequence
SNP Class: snp
Genotype: T
5'flank: TCGAATCCAATCCAATTAAAAAGAATCGAA
3'flank: CGAATCGAAAAGAATCGAATCGAAACTAAT
3.Reference Map information
Chrom Position Reference FAMBGSD00001
Chr20 253 G T
4.Gene information
Gene model(s)
Gene ID Position in Gene Strands Gene Allele Location
NA NA NA NA NA
Transcript Protein
SNP to transcript Accession Position in Transcript Allele change Accession Position in Protein Residue change
NA NA NA NA NA NA NA
5.SNPs of other individuals in this position
SNP_ID Individual Genotype 5' Near Seq 30 bp 3' Near Seq 30 bp Create time Last update time
snp_cf0037001444938 KM2 T TCGAATCCAATCCAATTAAAAAGAATCGAA CGAATCGAAAAGAATCGAATCGAAACTAAT 2014-07-19 2014-07-19
snp_cf0015001706199 DQ7 T TCGAATCCAATCCAATTAAAAAGAATCGAA CGAATCGAAAAGAATCGAATCGAAACTAAT 2014-07-19 2014-07-19
snp_cf0026001313202 GS2 T TCGAATCCAATCCAATTAAAAAGAATCGAA CGAATCGAAAAGAATCGAATCGAAACTAAT 2014-07-19 2014-07-19
snp_cf0049001721910 LJ4 T TCGAATCCAATCCAATTAAAAAGAATCGAA CGAATCGAAAAGAATCGAATCGAAACTAAT 2014-07-19 2014-07-19
snp_cf0052001666810 LJ7 T TCGAATCCAATCCAATTAAAAAGAATCGAA CGAATCGAAAAGAATCGAATCGAAACTAAT 2014-07-19 2014-07-19
snp_cf0076001760835 YJ7 T TCGAATCCAATCCAATTAAAAAGAATCGAA CGAATCGAAAAGAATCGAATCGAAACTAAT 2014-07-19 2014-07-19
snp_cf0044001508184 KM9 T TCGAATCCAATCCAATTAAAAAGAATCGAA CGAATCGAAAAGAATCGAATCGAAACTAAT 2014-07-19 2014-07-19
snp_cf0051001698910 LJ6 T TCGAATCCAATCCAATTAAAAAGAATCGAA CGAATCGAAAAGAATCGAATCGAAACTAAT 2014-07-19 2014-07-19
snp_cf0040001516397 KM5 T TCGAATCCAATCCAATTAAAAAGAATCGAA CGAATCGAAAAGAATCGAATCGAAACTAAT 2014-07-19 2014-07-19
snp_cf0074001724996 YJ5 T TCGAATCCAATCCAATTAAAAAGAATCGAA CGAATCGAAAAGAATCGAATCGAAACTAAT 2014-07-19 2014-07-19
snp_cf0025001331535 GS1 T TCGAATCCAATCCAATTAAAAAGAATCGAA CGAATCGAAAAGAATCGAATCGAAACTAAT 2014-07-19 2014-07-19
snp_cf0075001747522 YJ6 T TCGAATCCAATCCAATTAAAAAGAATCGAA CGAATCGAAAAGAATCGAATCGAAACTAAT 2014-07-19 2014-07-19
snp_cf0004001434464 Basenji T TCGAATCCAATCCAATTAAAAAGAATCGAA CGAATCGAAAAGAATCGAATCGAAACTAAT 2014-07-19 2014-07-19
snp_cf0027001339372 GS3 T TCGAATCCAATCCAATTAAAAAGAATCGAA CGAATCGAAAAGAATCGAATCGAAACTAAT 2014-07-19 2014-07-19
snp_cf0063001682285 TM4 T TCGAATCCAATCCAATTAAAAAGAATCGAA CGAATCGAAAAGAATCGAATCGAAACTAAT 2014-07-19 2014-07-19
snp_cf0050001583554 LJ5 T TCGAATCCAATCCAATTAAAAAGAATCGAA CGAATCGAAAAGAATCGAATCGAAACTAAT 2014-07-19 2014-07-19
snp_cf0059001700556 TM10 T TCGAATCCAATCCAATTAAAAAGAATCGAA CGAATCGAAAAGAATCGAATCGAAACTAAT 2014-07-19 2014-07-19
snp_cf0045001537200 LJ10 T TCGAATCCAATCCAATTAAAAAGAATCGAA CGAATCGAAAAGAATCGAATCGAAACTAAT 2014-07-19 2014-07-19
snp_cf0046001581128 LJ1 T TCGAATCCAATCCAATTAAAAAGAATCGAA CGAATCGAAAAGAATCGAATCGAAACTAAT 2014-07-19 2014-07-19
snp_cf0058002139448 LUPWRUS00003 T TCGAATCCAATCCAATTAAAAAGAATCGAA CGAATCGAAAAGAATCGAATCGAAACTAAT 2014-07-19 2014-07-19
snp_cf0021001625734 FAMICHN00001 T TCGAATCCAATCCAATTAAAAAGAATCGAA CGAATCGAAAAGAATCGAATCGAAACTAAT 2014-07-19 2014-07-19
snp_cf0072001754056 YJ3 T TCGAATCCAATCCAATTAAAAAGAATCGAA CGAATCGAAAAGAATCGAATCGAAACTAAT 2014-07-19 2014-07-19
snp_cf0047001654293 LJ2 T TCGAATCCAATCCAATTAAAAAGAATCGAA CGAATCGAAAAGAATCGAATCGAAACTAAT 2014-07-19 2014-07-19
snp_cf0008001705850 DQ10 T TCGAATCCAATCCAATTAAAAAGAATCGAA CGAATCGAAAAGAATCGAATCGAAACTAAT 2014-07-19 2014-07-19
snp_cf0009001709260 DQ1 T TCGAATCCAATCCAATTAAAAAGAATCGAA CGAATCGAAAAGAATCGAATCGAAACTAAT 2014-07-19 2014-07-19
snp_cf0071001742493 YJ2 T TCGAATCCAATCCAATTAAAAAGAATCGAA CGAATCGAAAAGAATCGAATCGAAACTAAT 2014-07-19 2014-07-19
snp_cf0048001618338 LJ3 T TCGAATCCAATCCAATTAAAAAGAATCGAA CGAATCGAAAAGAATCGAATCGAAACTAAT 2014-07-19 2014-07-19
snp_cf0056002161326 LUPWRUS00001 T TCGAATCCAATCCAATTAAAAAGAATCGAA CGAATCGAAAAGAATCGAATCGAAACTAAT 2014-07-19 2014-07-19
snp_cf0062001712581 TM3 T TCGAATCCAATCCAATTAAAAAGAATCGAA CGAATCGAAAAGAATCGAATCGAAACTAAT 2014-07-19 2014-07-19
snp_cf0006001975419 CRW T TCGAATCCAATCCAATTAAAAAGAATCGAA CGAATCGAAAAGAATCGAATCGAAACTAAT 2014-07-19 2014-07-19
snp_cf0061001732994 TM2 T TCGAATCCAATCCAATTAAAAAGAATCGAA CGAATCGAAAAGAATCGAATCGAAACTAAT 2014-07-19 2014-07-19
snp_cf0064001718178 TM5 T TCGAATCCAATCCAATTAAAAAGAATCGAA CGAATCGAAAAGAATCGAATCGAAACTAAT 2014-07-19 2014-07-19
snp_cf0066001742941 TM7 T TCGAATCCAATCCAATTAAAAAGAATCGAA CGAATCGAAAAGAATCGAATCGAAACTAAT 2014-07-19 2014-07-19
snp_cf0018001438695 FAMBBEM00001 T TCGAATCCAATCCAATTAAAAAGAATCGAA CGAATCGAAAAGAATCGAATCGAAACTAAT 2014-07-19 2014-07-19
snp_cf0022001528651 FAMICHN00002 T TCGAATCCAATCCAATTAAAAAGAATCGAA CGAATCGAAAAGAATCGAATCGAAACTAAT 2014-07-19 2014-07-19
snp_cf0033001343396 GS9 T TCGAATCCAATCCAATTAAAAAGAATCGAA CGAATCGAAAAGAATCGAATCGAAACTAAT 2014-07-19 2014-07-19
snp_cf0078001745819 YJ9 T TCGAATCCAATCCAATTAAAAAGAATCGAA CGAATCGAAAAGAATCGAATCGAAACTAAT 2014-07-19 2014-07-19
snp_cf0068001665328 TM9 T TCGAATCCAATCCAATTAAAAAGAATCGAA CGAATCGAAAAGAATCGAATCGAAACTAAT 2014-07-19 2014-07-19
snp_cf0017001726662 DQ9 T TCGAATCCAATCCAATTAAAAAGAATCGAA CGAATCGAAAAGAATCGAATCGAAACTAAT 2014-07-19 2014-07-19
snp_cf0005002029585 CHW T TCGAATCCAATCCAATTAAAAAGAATCGAA CGAATCGAAAAGAATCGAATCGAAACTAAT 2014-07-19 2014-07-19
snp_cf0070001805959 YJ1 T TCGAATCCAATCCAATTAAAAAGAATCGAA CGAATCGAAAAGAATCGAATCGAAACTAAT 2014-07-19 2014-07-19
snp_cf0042001786565 KM7 T TCGAATCCAATCCAATTAAAAAGAATCGAA CGAATCGAAAAGAATCGAATCGAAACTAAT 2014-07-19 2014-07-19
snp_cf0060001678406 TM1 T TCGAATCCAATCCAATTAAAAAGAATCGAA CGAATCGAAAAGAATCGAATCGAAACTAAT 2014-07-19 2014-07-19
snp_cf0069001765733 YJ10 T TCGAATCCAATCCAATTAAAAAGAATCGAA CGAATCGAAAAGAATCGAATCGAAACTAAT 2014-07-19 2014-07-19
snp_cf0014001678289 DQ6 T TCGAATCCAATCCAATTAAAAAGAATCGAA CGAATCGAAAAGAATCGAATCGAAACTAAT 2014-07-19 2014-07-19
snp_cf0067001677802 TM8 T TCGAATCCAATCCAATTAAAAAGAATCGAA CGAATCGAAAAGAATCGAATCGAAACTAAT 2014-07-19 2014-07-19
snp_cf0077001733764 YJ8 T TCGAATCCAATCCAATTAAAAAGAATCGAA CGAATCGAAAAGAATCGAATCGAAACTAAT 2014-07-19 2014-07-19
snp_cf0020001694880 FAMBTIM00001 T TCGAATCCAATCCAATTAAAAAGAATCGAA CGAATCGAAAAGAATCGAATCGAAACTAAT 2014-07-19 2014-07-19
snp_cf0016001711022 DQ8 T TCGAATCCAATCCAATTAAAAAGAATCGAA CGAATCGAAAAGAATCGAATCGAAACTAAT 2014-07-19 2014-07-19
snp_cf0023001602669 FAMICHN00003 T TCGAATCCAATCCAATTAAAAAGAATCGAA CGAATCGAAAAGAATCGAATCGAAACTAAT 2014-07-19 2014-07-19
snp_cf0055002134617 LUPWCHN00001 K TCGAATCCAATCCAATTAAAAAGAATCGAA CGAATCGAAAAGAATCGAATCGAAACTAAT 2014-07-19 2014-07-19
snp_cf0065001689452 TM6 T TCGAATCCAATCCAATTAAAAAGAATCGAA CGAATCGAAAAGAATCGAATCGAAACTAAT 2014-07-19 2014-07-19
snp_cf0035001656969 KM10 T TCGAATCCAATCCAATTAAAAAGAATCGAA CGAATCGAAAAGAATCGAATCGAAACTAAT 2014-07-19 2014-07-19
snp_cf0043001436326 KM8 T TCGAATCCAATCCAATTAAAAAGAATCGAA CGAATCGAAAAGAATCGAATCGAAACTAAT 2014-07-19 2014-07-19
snp_cf0011001733258 DQ3 T TCGAATCCAATCCAATTAAAAAGAATCGAA CGAATCGAAAAGAATCGAATCGAAACTAAT 2014-07-19 2014-07-19
snp_cf0073001702089 YJ4 T TCGAATCCAATCCAATTAAAAAGAATCGAA CGAATCGAAAAGAATCGAATCGAAACTAAT 2014-07-19 2014-07-19
snp_cf0041001725161 KM6 T TCGAATCCAATCCAATTAAAAAGAATCGAA CGAATCGAAAAGAATCGAATCGAAACTAAT 2014-07-19 2014-07-19
snp_cf0012001693085 DQ4 T TCGAATCCAATCCAATTAAAAAGAATCGAA CGAATCGAAAAGAATCGAATCGAAACTAAT 2014-07-19 2014-07-19
snp_cf0029001230361 GS5 T TCGAATCCAATCCAATTAAAAAGAATCGAA CGAATCGAAAAGAATCGAATCGAAACTAAT 2014-07-19 2014-07-19
snp_cf0030001325391 GS6 T TCGAATCCAATCCAATTAAAAAGAATCGAA CGAATCGAAAAGAATCGAATCGAAACTAAT 2014-07-19 2014-07-19
snp_cf0024001360236 GS10 T TCGAATCCAATCCAATTAAAAAGAATCGAA CGAATCGAAAAGAATCGAATCGAAACTAAT 2014-07-19 2014-07-19
snp_cf0038001351945 KM3 T TCGAATCCAATCCAATTAAAAAGAATCGAA CGAATCGAAAAGAATCGAATCGAAACTAAT 2014-07-19 2014-07-19
snp_cf0028001275180 GS4 T TCGAATCCAATCCAATTAAAAAGAATCGAA CGAATCGAAAAGAATCGAATCGAAACTAAT 2014-07-19 2014-07-19
snp_cf0010001684963 DQ2 T TCGAATCCAATCCAATTAAAAAGAATCGAA CGAATCGAAAAGAATCGAATCGAAACTAAT 2014-07-19 2014-07-19
snp_cf0034002012380 ISW T TCGAATCCAATCCAATTAAAAAGAATCGAA CGAATCGAAAAGAATCGAATCGAAACTAAT 2014-07-19 2014-07-19
snp_cf0053001658314 LJ8 T TCGAATCCAATCCAATTAAAAAGAATCGAA CGAATCGAAAAGAATCGAATCGAAACTAAT 2014-07-19 2014-07-19
snp_cf0007001469594 Dingo T TCGAATCCAATCCAATTAAAAAGAATCGAA CGAATCGAAAAGAATCGAATCGAAACTAAT 2014-07-19 2014-07-19
snp_cf0031001336086 GS7 T TCGAATCCAATCCAATTAAAAAGAATCGAA CGAATCGAAAAGAATCGAATCGAAACTAAT 2014-07-19 2014-07-19
snp_cf0036001341256 KM1 T TCGAATCCAATCCAATTAAAAAGAATCGAA CGAATCGAAAAGAATCGAATCGAAACTAAT 2014-07-19 2014-07-19
snp_cf0054001525413 LJ9 T TCGAATCCAATCCAATTAAAAAGAATCGAA CGAATCGAAAAGAATCGAATCGAAACTAAT 2014-07-19 2014-07-19
snp_cf0039001410938 KM4 T TCGAATCCAATCCAATTAAAAAGAATCGAA CGAATCGAAAAGAATCGAATCGAAACTAAT 2014-07-19 2014-07-19
snp_cf0032001311240 GS8 T TCGAATCCAATCCAATTAAAAAGAATCGAA CGAATCGAAAAGAATCGAATCGAAACTAAT 2014-07-19 2014-07-19
snp_cf0013001628660 DQ5 T TCGAATCCAATCCAATTAAAAAGAATCGAA CGAATCGAAAAGAATCGAATCGAAACTAAT 2014-07-19 2014-07-19
snp_cf0057002052036 LUPWRUS00002 T TCGAATCCAATCCAATTAAAAAGAATCGAA CGAATCGAAAAGAATCGAATCGAAACTAAT 2014-07-19 2014-07-19
6.Fasta Information
TCGAATCGTA TAGAATCGAA TCGAATCCAA TCCAATTAAA AAGAATCGAA
T
CGAATCGAAA AGAATCGAAT CGAAACTAAT TGAAAAGAAT AGAATCAAAT