e.g. 1:1246..9423
SNP Detail For snp_cf0019001305491    [See in GBrowse]
1.General Information
SNP ID: snp_cf0019001305491
Organism: Canis familiaris
Individual: FAMBGSD00001
Create time: 2014-07-19
Last update: 2014-07-19
2.Allele Information
Platform: SOLEXA
Method: sequence
SNP Class: snp
Genotype: A
5'flank: AATCGAATTGAATTGTAAAGAATCAAATCG
3'flank: ATTGAATCGAATCGGACAGAATTGAATCGA
3.Reference Map information
Chrom Position Reference FAMBGSD00001
Chr20 356 G A
4.Gene information
Gene model(s)
Gene ID Position in Gene Strands Gene Allele Location
NA NA NA NA NA
Transcript Protein
SNP to transcript Accession Position in Transcript Allele change Accession Position in Protein Residue change
NA NA NA NA NA NA NA
5.SNPs of other individuals in this position
SNP_ID Individual Genotype 5' Near Seq 30 bp 3' Near Seq 30 bp Create time Last update time
snp_cf0051001698912 LJ6 A AATCGAATTGAATTGTAAAGAATCAAATCG ATTGAATCGAATCGGACAGAATTGAATCGA 2014-07-19 2014-07-19
snp_cf0049001721912 LJ4 A AATCGAATTGAATTGTAAAGAATCAAATCG ATTGAATCGAATCGGACAGAATTGAATCGA 2014-07-19 2014-07-19
snp_cf0052001666812 LJ7 A AATCGAATTGAATTGTAAAGAATCAAATCG ATTGAATCGAATCGGACAGAATTGAATCGA 2014-07-19 2014-07-19
snp_cf0064001718180 TM5 A AATCGAATTGAATTGTAAAGAATCAAATCG ATTGAATCGAATCGGACAGAATTGAATCGA 2014-07-19 2014-07-19
snp_cf0058002139450 LUPWRUS00003 A AATCGAATTGAATTGTAAAGAATCAAATCG ATTGAATCGAATCGGACAGAATTGAATCGA 2014-07-19 2014-07-19
snp_cf0078001745821 YJ9 A AATCGAATTGAATTGTAAAGAATCAAATCG ATTGAATCGAATCGGACAGAATTGAATCGA 2014-07-19 2014-07-19
snp_cf0074001724998 YJ5 A AATCGAATTGAATTGTAAAGAATCAAATCG ATTGAATCGAATCGGACAGAATTGAATCGA 2014-07-19 2014-07-19
snp_cf0025001331537 GS1 A AATCGAATTGAATTGTAAAGAATCAAATCG ATTGAATCGAATCGGACAGAATTGAATCGA 2014-07-19 2014-07-19
snp_cf0044001508186 KM9 A AATCGAATTGAATTGTAAAGAATCAAATCG ATTGAATCGAATCGGACAGAATTGAATCGA 2014-07-19 2014-07-19
snp_cf0075001747524 YJ6 A AATCGAATTGAATTGTAAAGAATCAAATCG ATTGAATCGAATCGGACAGAATTGAATCGA 2014-07-19 2014-07-19
snp_cf0004001434466 Basenji A AATCGAATTGAATTGTAAAGAATCAAATCG ATTGAATCGAATCGGACAGAATTGAATCGA 2014-07-19 2014-07-19
snp_cf0050001583556 LJ5 A AATCGAATTGAATTGTAAAGAATCAAATCG ATTGAATCGAATCGGACAGAATTGAATCGA 2014-07-19 2014-07-19
snp_cf0009001709262 DQ1 A AATCGAATTGAATTGTAAAGAATCAAATCG ATTGAATCGAATCGGACAGAATTGAATCGA 2014-07-19 2014-07-19
snp_cf0039001410940 KM4 A AATCGAATTGAATTGTAAAGAATCAAATCG ATTGAATCGAATCGGACAGAATTGAATCGA 2014-07-19 2014-07-19
snp_cf0027001339374 GS3 A AATCGAATTGAATTGTAAAGAATCAAATCG ATTGAATCGAATCGGACAGAATTGAATCGA 2014-07-19 2014-07-19
snp_cf0008001705852 DQ10 A AATCGAATTGAATTGTAAAGAATCAAATCG ATTGAATCGAATCGGACAGAATTGAATCGA 2014-07-19 2014-07-19
snp_cf0045001537202 LJ10 A AATCGAATTGAATTGTAAAGAATCAAATCG ATTGAATCGAATCGGACAGAATTGAATCGA 2014-07-19 2014-07-19
snp_cf0063001682287 TM4 A AATCGAATTGAATTGTAAAGAATCAAATCG ATTGAATCGAATCGGACAGAATTGAATCGA 2014-07-19 2014-07-19
snp_cf0021001625736 FAMICHN00001 A AATCGAATTGAATTGTAAAGAATCAAATCG ATTGAATCGAATCGGACAGAATTGAATCGA 2014-07-19 2014-07-19
snp_cf0072001754058 YJ3 A AATCGAATTGAATTGTAAAGAATCAAATCG ATTGAATCGAATCGGACAGAATTGAATCGA 2014-07-19 2014-07-19
snp_cf0076001760837 YJ7 A AATCGAATTGAATTGTAAAGAATCAAATCG ATTGAATCGAATCGGACAGAATTGAATCGA 2014-07-19 2014-07-19
snp_cf0047001654295 LJ2 A AATCGAATTGAATTGTAAAGAATCAAATCG ATTGAATCGAATCGGACAGAATTGAATCGA 2014-07-19 2014-07-19
snp_cf0061001732996 TM2 A AATCGAATTGAATTGTAAAGAATCAAATCG ATTGAATCGAATCGGACAGAATTGAATCGA 2014-07-19 2014-07-19
snp_cf0018001438697 FAMBBEM00001 A AATCGAATTGAATTGTAAAGAATCAAATCG ATTGAATCGAATCGGACAGAATTGAATCGA 2014-07-19 2014-07-19
snp_cf0071001742495 YJ2 A AATCGAATTGAATTGTAAAGAATCAAATCG ATTGAATCGAATCGGACAGAATTGAATCGA 2014-07-19 2014-07-19
snp_cf0066001742943 TM7 A AATCGAATTGAATTGTAAAGAATCAAATCG ATTGAATCGAATCGGACAGAATTGAATCGA 2014-07-19 2014-07-19
snp_cf0033001343398 GS9 A AATCGAATTGAATTGTAAAGAATCAAATCG ATTGAATCGAATCGGACAGAATTGAATCGA 2014-07-19 2014-07-19
snp_cf0065001689454 TM6 A AATCGAATTGAATTGTAAAGAATCAAATCG ATTGAATCGAATCGGACAGAATTGAATCGA 2014-07-19 2014-07-19
snp_cf0022001528653 FAMICHN00002 A AATCGAATTGAATTGTAAAGAATCAAATCG ATTGAATCGAATCGGACAGAATTGAATCGA 2014-07-19 2014-07-19
snp_cf0017001726664 DQ9 A AATCGAATTGAATTGTAAAGAATCAAATCG ATTGAATCGAATCGGACAGAATTGAATCGA 2014-07-19 2014-07-19
snp_cf0068001665330 TM9 A AATCGAATTGAATTGTAAAGAATCAAATCG ATTGAATCGAATCGGACAGAATTGAATCGA 2014-07-19 2014-07-19
snp_cf0040001516399 KM5 A AATCGAATTGAATTGTAAAGAATCAAATCG ATTGAATCGAATCGGACAGAATTGAATCGA 2014-07-19 2014-07-19
snp_cf0006001975421 CRW A AATCGAATTGAATTGTAAAGAATCAAATCG ATTGAATCGAATCGGACAGAATTGAATCGA 2014-07-19 2014-07-19
snp_cf0026001313204 GS2 A AATCGAATTGAATTGTAAAGAATCAAATCG ATTGAATCGAATCGGACAGAATTGAATCGA 2014-07-19 2014-07-19
snp_cf0056002161328 LUPWRUS00001 A AATCGAATTGAATTGTAAAGAATCAAATCG ATTGAATCGAATCGGACAGAATTGAATCGA 2014-07-19 2014-07-19
snp_cf0042001786567 KM7 A AATCGAATTGAATTGTAAAGAATCAAATCG ATTGAATCGAATCGGACAGAATTGAATCGA 2014-07-19 2014-07-19
snp_cf0005002029587 CHW A AATCGAATTGAATTGTAAAGAATCAAATCG ATTGAATCGAATCGGACAGAATTGAATCGA 2014-07-19 2014-07-19
snp_cf0011001733260 DQ3 A AATCGAATTGAATTGTAAAGAATCAAATCG ATTGAATCGAATCGGACAGAATTGAATCGA 2014-07-19 2014-07-19
snp_cf0060001678408 TM1 A AATCGAATTGAATTGTAAAGAATCAAATCG ATTGAATCGAATCGGACAGAATTGAATCGA 2014-07-19 2014-07-19
snp_cf0069001765735 YJ10 A AATCGAATTGAATTGTAAAGAATCAAATCG ATTGAATCGAATCGGACAGAATTGAATCGA 2014-07-19 2014-07-19
snp_cf0067001677804 TM8 A AATCGAATTGAATTGTAAAGAATCAAATCG ATTGAATCGAATCGGACAGAATTGAATCGA 2014-07-19 2014-07-19
snp_cf0048001618340 LJ3 A AATCGAATTGAATTGTAAAGAATCAAATCG ATTGAATCGAATCGGACAGAATTGAATCGA 2014-07-19 2014-07-19
snp_cf0077001733766 YJ8 A AATCGAATTGAATTGTAAAGAATCAAATCG ATTGAATCGAATCGGACAGAATTGAATCGA 2014-07-19 2014-07-19
snp_cf0073001702091 YJ4 A AATCGAATTGAATTGTAAAGAATCAAATCG ATTGAATCGAATCGGACAGAATTGAATCGA 2014-07-19 2014-07-19
snp_cf0055002134619 LUPWCHN00001 A AATCGAATTGAATTGTAAAGAATCAAATCG ATTGAATCGAATCGGACAGAATTGAATCGA 2014-07-19 2014-07-19
snp_cf0023001602671 FAMICHN00003 A AATCGAATTGAATTGTAAAGAATCAAATCG ATTGAATCGAATCGGACAGAATTGAATCGA 2014-07-19 2014-07-19
snp_cf0035001656971 KM10 A AATCGAATTGAATTGTAAAGAATCAAATCG ATTGAATCGAATCGGACAGAATTGAATCGA 2014-07-19 2014-07-19
snp_cf0031001336088 GS7 A AATCGAATTGAATTGTAAAGAATCAAATCG ATTGAATCGAATCGGACAGAATTGAATCGA 2014-07-19 2014-07-19
snp_cf0016001711024 DQ8 A AATCGAATTGAATTGTAAAGAATCAAATCG ATTGAATCGAATCGGACAGAATTGAATCGA 2014-07-19 2014-07-19
snp_cf0020001694882 FAMBTIM00001 A AATCGAATTGAATTGTAAAGAATCAAATCG ATTGAATCGAATCGGACAGAATTGAATCGA 2014-07-19 2014-07-19
snp_cf0070001805961 YJ1 A AATCGAATTGAATTGTAAAGAATCAAATCG ATTGAATCGAATCGGACAGAATTGAATCGA 2014-07-19 2014-07-19
snp_cf0034002012382 ISW A AATCGAATTGAATTGTAAAGAATCAAATCG ATTGAATCGAATCGGACAGAATTGAATCGA 2014-07-19 2014-07-19
snp_cf0043001436328 KM8 A AATCGAATTGAATTGTAAAGAATCAAATCG ATTGAATCGAATCGGACAGAATTGAATCGA 2014-07-19 2014-07-19
snp_cf0062001712583 TM3 A AATCGAATTGAATTGTAAAGAATCAAATCG ATTGAATCGAATCGGACAGAATTGAATCGA 2014-07-19 2014-07-19
snp_cf0038001351947 KM3 A AATCGAATTGAATTGTAAAGAATCAAATCG ATTGAATCGAATCGGACAGAATTGAATCGA 2014-07-19 2014-07-19
snp_cf0029001230363 GS5 A AATCGAATTGAATTGTAAAGAATCAAATCG ATTGAATCGAATCGGACAGAATTGAATCGA 2014-07-19 2014-07-19
snp_cf0041001725163 KM6 A AATCGAATTGAATTGTAAAGAATCAAATCG ATTGAATCGAATCGGACAGAATTGAATCGA 2014-07-19 2014-07-19
snp_cf0012001693087 DQ4 A AATCGAATTGAATTGTAAAGAATCAAATCG ATTGAATCGAATCGGACAGAATTGAATCGA 2014-07-19 2014-07-19
snp_cf0024001360238 GS10 A AATCGAATTGAATTGTAAAGAATCAAATCG ATTGAATCGAATCGGACAGAATTGAATCGA 2014-07-19 2014-07-19
snp_cf0015001706201 DQ7 A AATCGAATTGAATTGTAAAGAATCAAATCG ATTGAATCGAATCGGACAGAATTGAATCGA 2014-07-19 2014-07-19
snp_cf0007001469596 Dingo A AATCGAATTGAATTGTAAAGAATCAAATCG ATTGAATCGAATCGGACAGAATTGAATCGA 2014-07-19 2014-07-19
snp_cf0030001325393 GS6 A AATCGAATTGAATTGTAAAGAATCAAATCG ATTGAATCGAATCGGACAGAATTGAATCGA 2014-07-19 2014-07-19
snp_cf0028001275182 GS4 A AATCGAATTGAATTGTAAAGAATCAAATCG ATTGAATCGAATCGGACAGAATTGAATCGA 2014-07-19 2014-07-19
snp_cf0010001684965 DQ2 A AATCGAATTGAATTGTAAAGAATCAAATCG ATTGAATCGAATCGGACAGAATTGAATCGA 2014-07-19 2014-07-19
snp_cf0059001700558 TM10 A AATCGAATTGAATTGTAAAGAATCAAATCG ATTGAATCGAATCGGACAGAATTGAATCGA 2014-07-19 2014-07-19
snp_cf0037001444940 KM2 A AATCGAATTGAATTGTAAAGAATCAAATCG ATTGAATCGAATCGGACAGAATTGAATCGA 2014-07-19 2014-07-19
snp_cf0053001658316 LJ8 A AATCGAATTGAATTGTAAAGAATCAAATCG ATTGAATCGAATCGGACAGAATTGAATCGA 2014-07-19 2014-07-19
snp_cf0036001341258 KM1 A AATCGAATTGAATTGTAAAGAATCAAATCG ATTGAATCGAATCGGACAGAATTGAATCGA 2014-07-19 2014-07-19
snp_cf0014001678291 DQ6 A AATCGAATTGAATTGTAAAGAATCAAATCG ATTGAATCGAATCGGACAGAATTGAATCGA 2014-07-19 2014-07-19
snp_cf0013001628662 DQ5 A AATCGAATTGAATTGTAAAGAATCAAATCG ATTGAATCGAATCGGACAGAATTGAATCGA 2014-07-19 2014-07-19
snp_cf0046001581130 LJ1 A AATCGAATTGAATTGTAAAGAATCAAATCG ATTGAATCGAATCGGACAGAATTGAATCGA 2014-07-19 2014-07-19
snp_cf0054001525415 LJ9 A AATCGAATTGAATTGTAAAGAATCAAATCG ATTGAATCGAATCGGACAGAATTGAATCGA 2014-07-19 2014-07-19
snp_cf0032001311242 GS8 A AATCGAATTGAATTGTAAAGAATCAAATCG ATTGAATCGAATCGGACAGAATTGAATCGA 2014-07-19 2014-07-19
snp_cf0057002052038 LUPWRUS00002 A AATCGAATTGAATTGTAAAGAATCAAATCG ATTGAATCGAATCGGACAGAATTGAATCGA 2014-07-19 2014-07-19
6.Fasta Information
AATTGAAAAG AAACGAAGCG AATCGAATTG AATTGTAAAG AATCAAATCG
A
ATTGAATCGA ATCGGACAGA ATTGAATCGA TCGAAAAGAA TCGAATTCGA