e.g. 1:1246..9423
SNP Detail For snp_cf0019001305492    [See in GBrowse]
1.General Information
SNP ID: snp_cf0019001305492
Organism: Canis familiaris
Individual: FAMBGSD00001
Create time: 2014-07-19
Last update: 2014-07-19
2.Allele Information
Platform: SOLEXA
Method: sequence
SNP Class: snp
Genotype: A
5'flank: CGAATTCGAATCAAATCGAAACGAATCGAA
3'flank: AGAATCGAATCGTTTCGAAAAGAATTGAAT
3.Reference Map information
Chrom Position Reference FAMBGSD00001
Chr20 428 G A
4.Gene information
Gene model(s)
Gene ID Position in Gene Strands Gene Allele Location
NA NA NA NA NA
Transcript Protein
SNP to transcript Accession Position in Transcript Allele change Accession Position in Protein Residue change
NA NA NA NA NA NA NA
5.SNPs of other individuals in this position
SNP_ID Individual Genotype 5' Near Seq 30 bp 3' Near Seq 30 bp Create time Last update time
snp_cf0052001666813 LJ7 A CGAATTCGAATCAAATCGAAACGAATCGAA AGAATCGAATCGTTTCGAAAAGAATTGAAT 2014-07-19 2014-07-19
snp_cf0064001718181 TM5 A CGAATTCGAATCAAATCGAAACGAATCGAA AGAATCGAATCGTTTCGAAAAGAATTGAAT 2014-07-19 2014-07-19
snp_cf0058002139451 LUPWRUS00003 A CGAATTCGAATCAAATCGAAACGAATCGAA AGAATCGAATCGTTTCGAAAAGAATTGAAT 2014-07-19 2014-07-19
snp_cf0051001698913 LJ6 A CGAATTCGAATCAAATCGAAACGAATCGAA AGAATCGAATCGTTTCGAAAAGAATTGAAT 2014-07-19 2014-07-19
snp_cf0025001331538 GS1 A CGAATTCGAATCAAATCGAAACGAATCGAA AGAATCGAATCGTTTCGAAAAGAATTGAAT 2014-07-19 2014-07-19
snp_cf0078001745822 YJ9 A CGAATTCGAATCAAATCGAAACGAATCGAA AGAATCGAATCGTTTCGAAAAGAATTGAAT 2014-07-19 2014-07-19
snp_cf0044001508187 KM9 A CGAATTCGAATCAAATCGAAACGAATCGAA AGAATCGAATCGTTTCGAAAAGAATTGAAT 2014-07-19 2014-07-19
snp_cf0049001721913 LJ4 A CGAATTCGAATCAAATCGAAACGAATCGAA AGAATCGAATCGTTTCGAAAAGAATTGAAT 2014-07-19 2014-07-19
snp_cf0050001583557 LJ5 A CGAATTCGAATCAAATCGAAACGAATCGAA AGAATCGAATCGTTTCGAAAAGAATTGAAT 2014-07-19 2014-07-19
snp_cf0075001747525 YJ6 A CGAATTCGAATCAAATCGAAACGAATCGAA AGAATCGAATCGTTTCGAAAAGAATTGAAT 2014-07-19 2014-07-19
snp_cf0039001410941 KM4 A CGAATTCGAATCAAATCGAAACGAATCGAA AGAATCGAATCGTTTCGAAAAGAATTGAAT 2014-07-19 2014-07-19
snp_cf0027001339375 GS3 A CGAATTCGAATCAAATCGAAACGAATCGAA AGAATCGAATCGTTTCGAAAAGAATTGAAT 2014-07-19 2014-07-19
snp_cf0009001709263 DQ1 A CGAATTCGAATCAAATCGAAACGAATCGAA AGAATCGAATCGTTTCGAAAAGAATTGAAT 2014-07-19 2014-07-19
snp_cf0008001705853 DQ10 A CGAATTCGAATCAAATCGAAACGAATCGAA AGAATCGAATCGTTTCGAAAAGAATTGAAT 2014-07-19 2014-07-19
snp_cf0045001537203 LJ10 A CGAATTCGAATCAAATCGAAACGAATCGAA AGAATCGAATCGTTTCGAAAAGAATTGAAT 2014-07-19 2014-07-19
snp_cf0021001625737 FAMICHN00001 A CGAATTCGAATCAAATCGAAACGAATCGAA AGAATCGAATCGTTTCGAAAAGAATTGAAT 2014-07-19 2014-07-19
snp_cf0072001754059 YJ3 A CGAATTCGAATCAAATCGAAACGAATCGAA AGAATCGAATCGTTTCGAAAAGAATTGAAT 2014-07-19 2014-07-19
snp_cf0076001760838 YJ7 A CGAATTCGAATCAAATCGAAACGAATCGAA AGAATCGAATCGTTTCGAAAAGAATTGAAT 2014-07-19 2014-07-19
snp_cf0047001654296 LJ2 A CGAATTCGAATCAAATCGAAACGAATCGAA AGAATCGAATCGTTTCGAAAAGAATTGAAT 2014-07-19 2014-07-19
snp_cf0063001682288 TM4 A CGAATTCGAATCAAATCGAAACGAATCGAA AGAATCGAATCGTTTCGAAAAGAATTGAAT 2014-07-19 2014-07-19
snp_cf0071001742496 YJ2 A CGAATTCGAATCAAATCGAAACGAATCGAA AGAATCGAATCGTTTCGAAAAGAATTGAAT 2014-07-19 2014-07-19
snp_cf0061001732997 TM2 A CGAATTCGAATCAAATCGAAACGAATCGAA AGAATCGAATCGTTTCGAAAAGAATTGAAT 2014-07-19 2014-07-19
snp_cf0066001742944 TM7 A CGAATTCGAATCAAATCGAAACGAATCGAA AGAATCGAATCGTTTCGAAAAGAATTGAAT 2014-07-19 2014-07-19
snp_cf0018001438698 FAMBBEM00001 A CGAATTCGAATCAAATCGAAACGAATCGAA AGAATCGAATCGTTTCGAAAAGAATTGAAT 2014-07-19 2014-07-19
snp_cf0065001689455 TM6 A CGAATTCGAATCAAATCGAAACGAATCGAA AGAATCGAATCGTTTCGAAAAGAATTGAAT 2014-07-19 2014-07-19
snp_cf0033001343399 GS9 A CGAATTCGAATCAAATCGAAACGAATCGAA AGAATCGAATCGTTTCGAAAAGAATTGAAT 2014-07-19 2014-07-19
snp_cf0022001528654 FAMICHN00002 A CGAATTCGAATCAAATCGAAACGAATCGAA AGAATCGAATCGTTTCGAAAAGAATTGAAT 2014-07-19 2014-07-19
snp_cf0042001786568 KM7 A CGAATTCGAATCAAATCGAAACGAATCGAA AGAATCGAATCGTTTCGAAAAGAATTGAAT 2014-07-19 2014-07-19
snp_cf0004001434467 Basenji A CGAATTCGAATCAAATCGAAACGAATCGAA AGAATCGAATCGTTTCGAAAAGAATTGAAT 2014-07-19 2014-07-19
snp_cf0068001665331 TM9 A CGAATTCGAATCAAATCGAAACGAATCGAA AGAATCGAATCGTTTCGAAAAGAATTGAAT 2014-07-19 2014-07-19
snp_cf0074001725000 YJ5 A CGAATTCGAATCAAATCGAAACGAATCGAA AGAATCGAATCGTTTCGAAAAGAATTGAAT 2014-07-19 2014-07-19
snp_cf0005002029588 CHW A CGAATTCGAATCAAATCGAAACGAATCGAA AGAATCGAATCGTTTCGAAAAGAATTGAAT 2014-07-19 2014-07-19
snp_cf0017001726665 DQ9 A CGAATTCGAATCAAATCGAAACGAATCGAA AGAATCGAATCGTTTCGAAAAGAATTGAAT 2014-07-19 2014-07-19
snp_cf0006001975422 CRW A CGAATTCGAATCAAATCGAAACGAATCGAA AGAATCGAATCGTTTCGAAAAGAATTGAAT 2014-07-19 2014-07-19
snp_cf0026001313205 GS2 A CGAATTCGAATCAAATCGAAACGAATCGAA AGAATCGAATCGTTTCGAAAAGAATTGAAT 2014-07-19 2014-07-19
snp_cf0056002161329 LUPWRUS00001 A CGAATTCGAATCAAATCGAAACGAATCGAA AGAATCGAATCGTTTCGAAAAGAATTGAAT 2014-07-19 2014-07-19
snp_cf0011001733261 DQ3 A CGAATTCGAATCAAATCGAAACGAATCGAA AGAATCGAATCGTTTCGAAAAGAATTGAAT 2014-07-19 2014-07-19
snp_cf0069001765736 YJ10 A CGAATTCGAATCAAATCGAAACGAATCGAA AGAATCGAATCGTTTCGAAAAGAATTGAAT 2014-07-19 2014-07-19
snp_cf0067001677805 TM8 A CGAATTCGAATCAAATCGAAACGAATCGAA AGAATCGAATCGTTTCGAAAAGAATTGAAT 2014-07-19 2014-07-19
snp_cf0073001702092 YJ4 A CGAATTCGAATCAAATCGAAACGAATCGAA AGAATCGAATCGTTTCGAAAAGAATTGAAT 2014-07-19 2014-07-19
snp_cf0077001733767 YJ8 A CGAATTCGAATCAAATCGAAACGAATCGAA AGAATCGAATCGTTTCGAAAAGAATTGAAT 2014-07-19 2014-07-19
snp_cf0048001618341 LJ3 A CGAATTCGAATCAAATCGAAACGAATCGAA AGAATCGAATCGTTTCGAAAAGAATTGAAT 2014-07-19 2014-07-19
snp_cf0023001602672 FAMICHN00003 A CGAATTCGAATCAAATCGAAACGAATCGAA AGAATCGAATCGTTTCGAAAAGAATTGAAT 2014-07-19 2014-07-19
snp_cf0035001656972 KM10 A CGAATTCGAATCAAATCGAAACGAATCGAA AGAATCGAATCGTTTCGAAAAGAATTGAAT 2014-07-19 2014-07-19
snp_cf0031001336089 GS7 A CGAATTCGAATCAAATCGAAACGAATCGAA AGAATCGAATCGTTTCGAAAAGAATTGAAT 2014-07-19 2014-07-19
snp_cf0016001711025 DQ8 A CGAATTCGAATCAAATCGAAACGAATCGAA AGAATCGAATCGTTTCGAAAAGAATTGAAT 2014-07-19 2014-07-19
snp_cf0070001805962 YJ1 A CGAATTCGAATCAAATCGAAACGAATCGAA AGAATCGAATCGTTTCGAAAAGAATTGAAT 2014-07-19 2014-07-19
snp_cf0043001436329 KM8 A CGAATTCGAATCAAATCGAAACGAATCGAA AGAATCGAATCGTTTCGAAAAGAATTGAAT 2014-07-19 2014-07-19
snp_cf0034002012383 ISW A CGAATTCGAATCAAATCGAAACGAATCGAA AGAATCGAATCGTTTCGAAAAGAATTGAAT 2014-07-19 2014-07-19
snp_cf0040001516400 KM5 A CGAATTCGAATCAAATCGAAACGAATCGAA AGAATCGAATCGTTTCGAAAAGAATTGAAT 2014-07-19 2014-07-19
snp_cf0020001694883 FAMBTIM00001 A CGAATTCGAATCAAATCGAAACGAATCGAA AGAATCGAATCGTTTCGAAAAGAATTGAAT 2014-07-19 2014-07-19
snp_cf0060001678409 TM1 A CGAATTCGAATCAAATCGAAACGAATCGAA AGAATCGAATCGTTTCGAAAAGAATTGAAT 2014-07-19 2014-07-19
snp_cf0062001712584 TM3 A CGAATTCGAATCAAATCGAAACGAATCGAA AGAATCGAATCGTTTCGAAAAGAATTGAAT 2014-07-19 2014-07-19
snp_cf0029001230364 GS5 A CGAATTCGAATCAAATCGAAACGAATCGAA AGAATCGAATCGTTTCGAAAAGAATTGAAT 2014-07-19 2014-07-19
snp_cf0007001469598 Dingo A CGAATTCGAATCAAATCGAAACGAATCGAA AGAATCGAATCGTTTCGAAAAGAATTGAAT 2014-07-19 2014-07-19
snp_cf0038001351948 KM3 A CGAATTCGAATCAAATCGAAACGAATCGAA AGAATCGAATCGTTTCGAAAAGAATTGAAT 2014-07-19 2014-07-19
snp_cf0012001693088 DQ4 A CGAATTCGAATCAAATCGAAACGAATCGAA AGAATCGAATCGTTTCGAAAAGAATTGAAT 2014-07-19 2014-07-19
snp_cf0024001360239 GS10 A CGAATTCGAATCAAATCGAAACGAATCGAA AGAATCGAATCGTTTCGAAAAGAATTGAAT 2014-07-19 2014-07-19
snp_cf0015001706202 DQ7 A CGAATTCGAATCAAATCGAAACGAATCGAA AGAATCGAATCGTTTCGAAAAGAATTGAAT 2014-07-19 2014-07-19
snp_cf0041001725164 KM6 A CGAATTCGAATCAAATCGAAACGAATCGAA AGAATCGAATCGTTTCGAAAAGAATTGAAT 2014-07-19 2014-07-19
snp_cf0030001325394 GS6 A CGAATTCGAATCAAATCGAAACGAATCGAA AGAATCGAATCGTTTCGAAAAGAATTGAAT 2014-07-19 2014-07-19
snp_cf0037001444941 KM2 A CGAATTCGAATCAAATCGAAACGAATCGAA AGAATCGAATCGTTTCGAAAAGAATTGAAT 2014-07-19 2014-07-19
snp_cf0028001275183 GS4 A CGAATTCGAATCAAATCGAAACGAATCGAA AGAATCGAATCGTTTCGAAAAGAATTGAAT 2014-07-19 2014-07-19
snp_cf0036001341259 KM1 A CGAATTCGAATCAAATCGAAACGAATCGAA AGAATCGAATCGTTTCGAAAAGAATTGAAT 2014-07-19 2014-07-19
snp_cf0010001684966 DQ2 A CGAATTCGAATCAAATCGAAACGAATCGAA AGAATCGAATCGTTTCGAAAAGAATTGAAT 2014-07-19 2014-07-19
snp_cf0053001658317 LJ8 A CGAATTCGAATCAAATCGAAACGAATCGAA AGAATCGAATCGTTTCGAAAAGAATTGAAT 2014-07-19 2014-07-19
snp_cf0014001678292 DQ6 A CGAATTCGAATCAAATCGAAACGAATCGAA AGAATCGAATCGTTTCGAAAAGAATTGAAT 2014-07-19 2014-07-19
snp_cf0013001628663 DQ5 A CGAATTCGAATCAAATCGAAACGAATCGAA AGAATCGAATCGTTTCGAAAAGAATTGAAT 2014-07-19 2014-07-19
snp_cf0046001581131 LJ1 A CGAATTCGAATCAAATCGAAACGAATCGAA AGAATCGAATCGTTTCGAAAAGAATTGAAT 2014-07-19 2014-07-19
snp_cf0059001700560 TM10 A CGAATTCGAATCAAATCGAAACGAATCGAA AGAATCGAATCGTTTCGAAAAGAATTGAAT 2014-07-19 2014-07-19
snp_cf0054001525416 LJ9 A CGAATTCGAATCAAATCGAAACGAATCGAA AGAATCGAATCGTTTCGAAAAGAATTGAAT 2014-07-19 2014-07-19
snp_cf0032001311243 GS8 A CGAATTCGAATCAAATCGAAACGAATCGAA AGAATCGAATCGTTTCGAAAAGAATTGAAT 2014-07-19 2014-07-19
snp_cf0057002052039 LUPWRUS00002 A CGAATTCGAATCAAATCGAAACGAATCGAA AGAATCGAATCGTTTCGAAAAGAATTGAAT 2014-07-19 2014-07-19
snp_cf0055002134620 LUPWCHN00001 A CGAATTCGAATCAAATCGAAACGAATCGAA AGAATCGAATCGTTTCGAAAAGAATTGAAT 2014-07-19 2014-07-19
6.Fasta Information
TTGAATCGAT CGAAAAGAAT CGAATTCGAA TCAAATCGAA ACGAATCGAA
A
AGAATCGAAT CGTTTCGAAA AGAATTGAAT CGAATCGAAT CGAATAGAAA