e.g. 1:1246..9423
SNP Detail For snp_cf0019001305493    [See in GBrowse]
1.General Information
SNP ID: snp_cf0019001305493
Organism: Canis familiaris
Individual: FAMBGSD00001
Create time: 2014-07-19
Last update: 2014-07-19
2.Allele Information
Platform: SOLEXA
Method: sequence
SNP Class: snp
Genotype: Y
5'flank: TGGAAAAGAATAGAATCGAATTGAATGGAA
3'flank: CGAATCGAAAAGAATCGAATCGAATAGAAT
3.Reference Map information
Chrom Position Reference FAMBGSD00001
Chr20 1562 T Y
4.Gene information
Gene model(s)
Gene ID Position in Gene Strands Gene Allele Location
NA NA NA NA NA
Transcript Protein
SNP to transcript Accession Position in Transcript Allele change Accession Position in Protein Residue change
NA NA NA NA NA NA NA
5.SNPs of other individuals in this position
SNP_ID Individual Genotype 5' Near Seq 30 bp 3' Near Seq 30 bp Create time Last update time
snp_cf0051001698914 LJ6 Y TGGAAAAGAATAGAATCGAATTGAATGGAA CGAATCGAAAAGAATCGAATCGAATAGAAT 2014-07-19 2014-07-19
snp_cf0038001351949 KM3 C TGGAAAAGAATAGAATCGAATTGAATGGAA CGAATCGAAAAGAATCGAATCGAATAGAAT 2014-07-19 2014-07-19
snp_cf0078001745823 YJ9 Y TGGAAAAGAATAGAATCGAATTGAATGGAA CGAATCGAAAAGAATCGAATCGAATAGAAT 2014-07-19 2014-07-19
snp_cf0041001725165 KM6 Y TGGAAAAGAATAGAATCGAATTGAATGGAA CGAATCGAAAAGAATCGAATCGAATAGAAT 2014-07-19 2014-07-19
snp_cf0025001331539 GS1 C TGGAAAAGAATAGAATCGAATTGAATGGAA CGAATCGAAAAGAATCGAATCGAATAGAAT 2014-07-19 2014-07-19
snp_cf0018001438699 FAMBBEM00001 C TGGAAAAGAATAGAATCGAATTGAATGGAA CGAATCGAAAAGAATCGAATCGAATAGAAT 2014-07-19 2014-07-19
snp_cf0071001742497 YJ2 Y TGGAAAAGAATAGAATCGAATTGAATGGAA CGAATCGAAAAGAATCGAATCGAATAGAAT 2014-07-19 2014-07-19
snp_cf0031001336090 GS7 C TGGAAAAGAATAGAATCGAATTGAATGGAA CGAATCGAAAAGAATCGAATCGAATAGAAT 2014-07-19 2014-07-19
snp_cf0052001666814 LJ7 Y TGGAAAAGAATAGAATCGAATTGAATGGAA CGAATCGAAAAGAATCGAATCGAATAGAAT 2014-07-19 2014-07-19
snp_cf0033001343400 GS9 Y TGGAAAAGAATAGAATCGAATTGAATGGAA CGAATCGAAAAGAATCGAATCGAATAGAAT 2014-07-19 2014-07-19
snp_cf0077001733769 YJ8 Y TGGAAAAGAATAGAATCGAATTGAATGGAA CGAATCGAAAAGAATCGAATCGAATAGAAT 2014-07-19 2014-07-19
snp_cf0028001275184 GS4 C TGGAAAAGAATAGAATCGAATTGAATGGAA CGAATCGAAAAGAATCGAATCGAATAGAAT 2014-07-19 2014-07-19
snp_cf0024001360240 GS10 C TGGAAAAGAATAGAATCGAATTGAATGGAA CGAATCGAAAAGAATCGAATCGAATAGAAT 2014-07-19 2014-07-19
snp_cf0035001656973 KM10 Y TGGAAAAGAATAGAATCGAATTGAATGGAA CGAATCGAAAAGAATCGAATCGAATAGAAT 2014-07-19 2014-07-19
snp_cf0042001786569 KM7 Y TGGAAAAGAATAGAATCGAATTGAATGGAA CGAATCGAAAAGAATCGAATCGAATAGAAT 2014-07-19 2014-07-19
snp_cf0039001410942 KM4 Y TGGAAAAGAATAGAATCGAATTGAATGGAA CGAATCGAAAAGAATCGAATCGAATAGAAT 2014-07-19 2014-07-19
snp_cf0030001325395 GS6 C TGGAAAAGAATAGAATCGAATTGAATGGAA CGAATCGAAAAGAATCGAATCGAATAGAAT 2014-07-19 2014-07-19
snp_cf0040001516401 KM5 Y TGGAAAAGAATAGAATCGAATTGAATGGAA CGAATCGAAAAGAATCGAATCGAATAGAAT 2014-07-19 2014-07-19
snp_cf0027001339376 GS3 C TGGAAAAGAATAGAATCGAATTGAATGGAA CGAATCGAAAAGAATCGAATCGAATAGAAT 2014-07-19 2014-07-19
snp_cf0026001313206 GS2 Y TGGAAAAGAATAGAATCGAATTGAATGGAA CGAATCGAAAAGAATCGAATCGAATAGAAT 2014-07-19 2014-07-19
snp_cf0032001311244 GS8 C TGGAAAAGAATAGAATCGAATTGAATGGAA CGAATCGAAAAGAATCGAATCGAATAGAAT 2014-07-19 2014-07-19
snp_cf0029001230365 GS5 Y TGGAAAAGAATAGAATCGAATTGAATGGAA CGAATCGAAAAGAATCGAATCGAATAGAAT 2014-07-19 2014-07-19
6.Fasta Information
TCAAATCGTA TCGAATCGAA TGGAAAAGAA TAGAATCGAA TTGAATGGAA
Y
CGAATCGAAA AGAATCGAAT CGAATAGAAT AGAATCGAAT AGAATAGAAA