e.g. 1:1246..9423
SNP Detail For snp_cf0019001305494    [See in GBrowse]
1.General Information
SNP ID: snp_cf0019001305494
Organism: Canis familiaris
Individual: FAMBGSD00001
Create time: 2014-07-19
Last update: 2014-07-19
2.Allele Information
Platform: SOLEXA
Method: sequence
SNP Class: snp
Genotype: R
5'flank: GCATCGAATCGAATAGAAATGAATCGAATC
3'flank: AAAAGAATCAAATTGAATCGAATAGAAAAT
3.Reference Map information
Chrom Position Reference FAMBGSD00001
Chr20 1773 A R
4.Gene information
Gene model(s)
Gene ID Position in Gene Strands Gene Allele Location
NA NA NA NA NA
Transcript Protein
SNP to transcript Accession Position in Transcript Allele change Accession Position in Protein Residue change
NA NA NA NA NA NA NA
5.SNPs of other individuals in this position
SNP_ID Individual Genotype 5' Near Seq 30 bp 3' Near Seq 30 bp Create time Last update time
snp_cf0078001745824 YJ9 R GCATCGAATCGAATAGAAATGAATCGAATC AAAAGAATCAAATTGAATCGAATAGAAAAT 2014-07-19 2014-07-19
snp_cf0052001666815 LJ7 R GCATCGAATCGAATAGAAATGAATCGAATC AAAAGAATCAAATTGAATCGAATAGAAAAT 2014-07-19 2014-07-19
snp_cf0072001754060 YJ3 G GCATCGAATCGAATAGAAATGAATCGAATC AAAAGAATCAAATTGAATCGAATAGAAAAT 2014-07-19 2014-07-19
snp_cf0064001718183 TM5 G GCATCGAATCGAATAGAAATGAATCGAATC AAAAGAATCAAATTGAATCGAATAGAAAAT 2014-07-19 2014-07-19
snp_cf0049001721914 LJ4 G GCATCGAATCGAATAGAAATGAATCGAATC AAAAGAATCAAATTGAATCGAATAGAAAAT 2014-07-19 2014-07-19
snp_cf0044001508188 KM9 R GCATCGAATCGAATAGAAATGAATCGAATC AAAAGAATCAAATTGAATCGAATAGAAAAT 2014-07-19 2014-07-19
snp_cf0075001747526 YJ6 G GCATCGAATCGAATAGAAATGAATCGAATC AAAAGAATCAAATTGAATCGAATAGAAAAT 2014-07-19 2014-07-19
snp_cf0021001625739 FAMICHN00001 R GCATCGAATCGAATAGAAATGAATCGAATC AAAAGAATCAAATTGAATCGAATAGAAAAT 2014-07-19 2014-07-19
snp_cf0039001410943 KM4 R GCATCGAATCGAATAGAAATGAATCGAATC AAAAGAATCAAATTGAATCGAATAGAAAAT 2014-07-19 2014-07-19
snp_cf0009001709264 DQ1 G GCATCGAATCGAATAGAAATGAATCGAATC AAAAGAATCAAATTGAATCGAATAGAAAAT 2014-07-19 2014-07-19
snp_cf0047001654297 LJ2 G GCATCGAATCGAATAGAAATGAATCGAATC AAAAGAATCAAATTGAATCGAATAGAAAAT 2014-07-19 2014-07-19
snp_cf0008001705854 DQ10 G GCATCGAATCGAATAGAAATGAATCGAATC AAAAGAATCAAATTGAATCGAATAGAAAAT 2014-07-19 2014-07-19
snp_cf0051001698915 LJ6 R GCATCGAATCGAATAGAAATGAATCGAATC AAAAGAATCAAATTGAATCGAATAGAAAAT 2014-07-19 2014-07-19
snp_cf0063001682289 TM4 G GCATCGAATCGAATAGAAATGAATCGAATC AAAAGAATCAAATTGAATCGAATAGAAAAT 2014-07-19 2014-07-19
snp_cf0029001230366 GS5 R GCATCGAATCGAATAGAAATGAATCGAATC AAAAGAATCAAATTGAATCGAATAGAAAAT 2014-07-19 2014-07-19
snp_cf0076001760839 YJ7 G GCATCGAATCGAATAGAAATGAATCGAATC AAAAGAATCAAATTGAATCGAATAGAAAAT 2014-07-19 2014-07-19
snp_cf0061001732998 TM2 G GCATCGAATCGAATAGAAATGAATCGAATC AAAAGAATCAAATTGAATCGAATAGAAAAT 2014-07-19 2014-07-19
snp_cf0066001742945 TM7 G GCATCGAATCGAATAGAAATGAATCGAATC AAAAGAATCAAATTGAATCGAATAGAAAAT 2014-07-19 2014-07-19
snp_cf0042001786570 KM7 R GCATCGAATCGAATAGAAATGAATCGAATC AAAAGAATCAAATTGAATCGAATAGAAAAT 2014-07-19 2014-07-19
snp_cf0060001678410 TM1 G GCATCGAATCGAATAGAAATGAATCGAATC AAAAGAATCAAATTGAATCGAATAGAAAAT 2014-07-19 2014-07-19
snp_cf0022001528655 FAMICHN00002 G GCATCGAATCGAATAGAAATGAATCGAATC AAAAGAATCAAATTGAATCGAATAGAAAAT 2014-07-19 2014-07-19
snp_cf0065001689457 TM6 G GCATCGAATCGAATAGAAATGAATCGAATC AAAAGAATCAAATTGAATCGAATAGAAAAT 2014-07-19 2014-07-19
snp_cf0050001583560 LJ5 R GCATCGAATCGAATAGAAATGAATCGAATC AAAAGAATCAAATTGAATCGAATAGAAAAT 2014-07-19 2014-07-19
snp_cf0068001665332 TM9 G GCATCGAATCGAATAGAAATGAATCGAATC AAAAGAATCAAATTGAATCGAATAGAAAAT 2014-07-19 2014-07-19
snp_cf0026001313207 GS2 R GCATCGAATCGAATAGAAATGAATCGAATC AAAAGAATCAAATTGAATCGAATAGAAAAT 2014-07-19 2014-07-19
snp_cf0074001725002 YJ5 G GCATCGAATCGAATAGAAATGAATCGAATC AAAAGAATCAAATTGAATCGAATAGAAAAT 2014-07-19 2014-07-19
snp_cf0006001975424 CRW R GCATCGAATCGAATAGAAATGAATCGAATC AAAAGAATCAAATTGAATCGAATAGAAAAT 2014-07-19 2014-07-19
snp_cf0005002029589 CHW R GCATCGAATCGAATAGAAATGAATCGAATC AAAAGAATCAAATTGAATCGAATAGAAAAT 2014-07-19 2014-07-19
snp_cf0017001726666 DQ9 G GCATCGAATCGAATAGAAATGAATCGAATC AAAAGAATCAAATTGAATCGAATAGAAAAT 2014-07-19 2014-07-19
snp_cf0069001765738 YJ10 G GCATCGAATCGAATAGAAATGAATCGAATC AAAAGAATCAAATTGAATCGAATAGAAAAT 2014-07-19 2014-07-19
snp_cf0043001436330 KM8 G GCATCGAATCGAATAGAAATGAATCGAATC AAAAGAATCAAATTGAATCGAATAGAAAAT 2014-07-19 2014-07-19
snp_cf0011001733262 DQ3 G GCATCGAATCGAATAGAAATGAATCGAATC AAAAGAATCAAATTGAATCGAATAGAAAAT 2014-07-19 2014-07-19
snp_cf0073001702093 YJ4 G GCATCGAATCGAATAGAAATGAATCGAATC AAAAGAATCAAATTGAATCGAATAGAAAAT 2014-07-19 2014-07-19
snp_cf0067001677806 TM8 G GCATCGAATCGAATAGAAATGAATCGAATC AAAAGAATCAAATTGAATCGAATAGAAAAT 2014-07-19 2014-07-19
snp_cf0033001343401 GS9 R GCATCGAATCGAATAGAAATGAATCGAATC AAAAGAATCAAATTGAATCGAATAGAAAAT 2014-07-19 2014-07-19
snp_cf0023001602673 FAMICHN00003 G GCATCGAATCGAATAGAAATGAATCGAATC AAAAGAATCAAATTGAATCGAATAGAAAAT 2014-07-19 2014-07-19
snp_cf0048001618343 LJ3 R GCATCGAATCGAATAGAAATGAATCGAATC AAAAGAATCAAATTGAATCGAATAGAAAAT 2014-07-19 2014-07-19
snp_cf0077001733770 YJ8 R GCATCGAATCGAATAGAAATGAATCGAATC AAAAGAATCAAATTGAATCGAATAGAAAAT 2014-07-19 2014-07-19
snp_cf0070001805964 YJ1 R GCATCGAATCGAATAGAAATGAATCGAATC AAAAGAATCAAATTGAATCGAATAGAAAAT 2014-07-19 2014-07-19
snp_cf0034002012384 ISW R GCATCGAATCGAATAGAAATGAATCGAATC AAAAGAATCAAATTGAATCGAATAGAAAAT 2014-07-19 2014-07-19
snp_cf0016001711026 DQ8 G GCATCGAATCGAATAGAAATGAATCGAATC AAAAGAATCAAATTGAATCGAATAGAAAAT 2014-07-19 2014-07-19
snp_cf0040001516402 KM5 R GCATCGAATCGAATAGAAATGAATCGAATC AAAAGAATCAAATTGAATCGAATAGAAAAT 2014-07-19 2014-07-19
snp_cf0020001694884 FAMBTIM00001 G GCATCGAATCGAATAGAAATGAATCGAATC AAAAGAATCAAATTGAATCGAATAGAAAAT 2014-07-19 2014-07-19
snp_cf0062001712585 TM3 G GCATCGAATCGAATAGAAATGAATCGAATC AAAAGAATCAAATTGAATCGAATAGAAAAT 2014-07-19 2014-07-19
snp_cf0007001469599 Dingo G GCATCGAATCGAATAGAAATGAATCGAATC AAAAGAATCAAATTGAATCGAATAGAAAAT 2014-07-19 2014-07-19
snp_cf0045001537204 LJ10 R GCATCGAATCGAATAGAAATGAATCGAATC AAAAGAATCAAATTGAATCGAATAGAAAAT 2014-07-19 2014-07-19
snp_cf0012001693089 DQ4 G GCATCGAATCGAATAGAAATGAATCGAATC AAAAGAATCAAATTGAATCGAATAGAAAAT 2014-07-19 2014-07-19
snp_cf0041001725166 KM6 R GCATCGAATCGAATAGAAATGAATCGAATC AAAAGAATCAAATTGAATCGAATAGAAAAT 2014-07-19 2014-07-19
snp_cf0037001444942 KM2 G GCATCGAATCGAATAGAAATGAATCGAATC AAAAGAATCAAATTGAATCGAATAGAAAAT 2014-07-19 2014-07-19
snp_cf0010001684967 DQ2 G GCATCGAATCGAATAGAAATGAATCGAATC AAAAGAATCAAATTGAATCGAATAGAAAAT 2014-07-19 2014-07-19
snp_cf0014001678294 DQ6 G GCATCGAATCGAATAGAAATGAATCGAATC AAAAGAATCAAATTGAATCGAATAGAAAAT 2014-07-19 2014-07-19
snp_cf0015001706203 DQ7 R GCATCGAATCGAATAGAAATGAATCGAATC AAAAGAATCAAATTGAATCGAATAGAAAAT 2014-07-19 2014-07-19
snp_cf0053001658318 LJ8 R GCATCGAATCGAATAGAAATGAATCGAATC AAAAGAATCAAATTGAATCGAATAGAAAAT 2014-07-19 2014-07-19
snp_cf0013001628664 DQ5 G GCATCGAATCGAATAGAAATGAATCGAATC AAAAGAATCAAATTGAATCGAATAGAAAAT 2014-07-19 2014-07-19
snp_cf0035001656974 KM10 R GCATCGAATCGAATAGAAATGAATCGAATC AAAAGAATCAAATTGAATCGAATAGAAAAT 2014-07-19 2014-07-19
snp_cf0059001700561 TM10 G GCATCGAATCGAATAGAAATGAATCGAATC AAAAGAATCAAATTGAATCGAATAGAAAAT 2014-07-19 2014-07-19
snp_cf0046001581132 LJ1 G GCATCGAATCGAATAGAAATGAATCGAATC AAAAGAATCAAATTGAATCGAATAGAAAAT 2014-07-19 2014-07-19
snp_cf0054001525417 LJ9 G GCATCGAATCGAATAGAAATGAATCGAATC AAAAGAATCAAATTGAATCGAATAGAAAAT 2014-07-19 2014-07-19
snp_cf0036001341260 KM1 G GCATCGAATCGAATAGAAATGAATCGAATC AAAAGAATCAAATTGAATCGAATAGAAAAT 2014-07-19 2014-07-19
6.Fasta Information
GAATACAATC GAATTGCCTC GCATCGAATC GAATAGAAAT GAATCGAATC
R
AAAAGAATCA AATTGAATCG AATAGAAAAT AATCAAATCG AATCGATTCA