e.g. 1:1246..9423
SNP Detail For snp_cf0019000000226    [See in GBrowse]
1.General Information
SNP ID: snp_cf0019000000226
Organism: Canis familiaris
Individual: FAMBGSD00001
Create time: 2014-07-19
Last update: 2014-07-19
NCBI rs link rs21953191  
2.Allele Information
Platform: SOLEXA
Method: sequence
SNP Class: snp
Genotype: G
5'flank: GTTTTGGAGCAATGTGCATTTGCTTCAAAA
3'flank: TCCAGGTTTCTTAATATGTTCTGAAATCAC
3.Reference Map information
Chrom Position Reference FAMBGSD00001
Chr1 604894 A G
4.Gene information
Gene model(s)
Gene ID Position in Gene Strands Gene Allele Location
ENSCAFG00000000007 30447 - A CDS
Transcript Protein
SNP to transcript Accession Position in Transcript Allele change Accession Position in Protein Residue change
- ENSCAFT00000000008 775 TTT => CTT ENSCAFP00000000007 259 F => L
5.SNPs of other individuals in this position
SNP_ID Individual Genotype 5' Near Seq 30 bp 3' Near Seq 30 bp Create time Last update time
snp_cf0035000000215 KM10 G GTTTTGGAGCAATGTGCATTTGCTTCAAAA TCCAGGTTTCTTAATATGTTCTGAAATCAC 2014-07-19 2014-07-19
snp_cf0061000000197 TM2 G GTTTTGGAGCAATGTGCATTTGCTTCAAAA TCCAGGTTTCTTAATATGTTCTGAAATCAC 2014-07-19 2014-07-19
snp_cf0023000000176 FAMICHN00003 G GTTTTGGAGCAATGTGCATTTGCTTCAAAA TCCAGGTTTCTTAATATGTTCTGAAATCAC 2014-07-19 2014-07-19
snp_cf0014000000186 DQ6 G GTTTTGGAGCAATGTGCATTTGCTTCAAAA TCCAGGTTTCTTAATATGTTCTGAAATCAC 2014-07-19 2014-07-19
snp_cf0055000000275 LUPWCHN00001 G GTTTTGGAGCAATGTGCATTTGCTTCAAAA TCCAGGTTTCTTAATATGTTCTGAAATCAC 2014-07-19 2014-07-19
snp_cf0018000000469 FAMBBEM00001 G GTTTTGGAGCAATGTGCATTTGCTTCAAAA TCCAGGTTTCTTAATATGTTCTGAAATCAC 2014-07-19 2014-07-19
snp_cf0078000000214 YJ9 G GTTTTGGAGCAATGTGCATTTGCTTCAAAA TCCAGGTTTCTTAATATGTTCTGAAATCAC 2014-07-19 2014-07-19
snp_cf0017000000182 DQ9 G GTTTTGGAGCAATGTGCATTTGCTTCAAAA TCCAGGTTTCTTAATATGTTCTGAAATCAC 2014-07-19 2014-07-19
snp_cf0025000000237 GS1 G GTTTTGGAGCAATGTGCATTTGCTTCAAAA TCCAGGTTTCTTAATATGTTCTGAAATCAC 2014-07-19 2014-07-19
snp_cf0028000000159 GS4 G GTTTTGGAGCAATGTGCATTTGCTTCAAAA TCCAGGTTTCTTAATATGTTCTGAAATCAC 2014-07-19 2014-07-19
snp_cf0066000000173 TM7 G GTTTTGGAGCAATGTGCATTTGCTTCAAAA TCCAGGTTTCTTAATATGTTCTGAAATCAC 2014-07-19 2014-07-19
snp_cf0072000000173 YJ3 G GTTTTGGAGCAATGTGCATTTGCTTCAAAA TCCAGGTTTCTTAATATGTTCTGAAATCAC 2014-07-19 2014-07-19
snp_cf0043000000511 KM8 G GTTTTGGAGCAATGTGCATTTGCTTCAAAA TCCAGGTTTCTTAATATGTTCTGAAATCAC 2014-07-19 2014-07-19
snp_cf0034000000432 ISW G GTTTTGGAGCAATGTGCATTTGCTTCAAAA TCCAGGTTTCTTAATATGTTCTGAAATCAC 2014-07-19 2014-07-19
snp_cf0022000000198 FAMICHN00002 G GTTTTGGAGCAATGTGCATTTGCTTCAAAA TCCAGGTTTCTTAATATGTTCTGAAATCAC 2014-07-19 2014-07-19
snp_cf0064000000206 TM5 G GTTTTGGAGCAATGTGCATTTGCTTCAAAA TCCAGGTTTCTTAATATGTTCTGAAATCAC 2014-07-19 2014-07-19
snp_cf0013000000176 DQ5 G GTTTTGGAGCAATGTGCATTTGCTTCAAAA TCCAGGTTTCTTAATATGTTCTGAAATCAC 2014-07-19 2014-07-19
snp_cf0069000000174 YJ10 G GTTTTGGAGCAATGTGCATTTGCTTCAAAA TCCAGGTTTCTTAATATGTTCTGAAATCAC 2014-07-19 2014-07-19
snp_cf0041000000247 KM6 G GTTTTGGAGCAATGTGCATTTGCTTCAAAA TCCAGGTTTCTTAATATGTTCTGAAATCAC 2014-07-19 2014-07-19
snp_cf0046000000170 LJ1 G GTTTTGGAGCAATGTGCATTTGCTTCAAAA TCCAGGTTTCTTAATATGTTCTGAAATCAC 2014-07-19 2014-07-19
snp_cf0059000000182 TM10 G GTTTTGGAGCAATGTGCATTTGCTTCAAAA TCCAGGTTTCTTAATATGTTCTGAAATCAC 2014-07-19 2014-07-19
snp_cf0011000000172 DQ3 G GTTTTGGAGCAATGTGCATTTGCTTCAAAA TCCAGGTTTCTTAATATGTTCTGAAATCAC 2014-07-19 2014-07-19
snp_cf0005000000175 CHW G GTTTTGGAGCAATGTGCATTTGCTTCAAAA TCCAGGTTTCTTAATATGTTCTGAAATCAC 2014-07-19 2014-07-19
snp_cf0037000000195 KM2 G GTTTTGGAGCAATGTGCATTTGCTTCAAAA TCCAGGTTTCTTAATATGTTCTGAAATCAC 2014-07-19 2014-07-19
snp_cf0068000000158 TM9 G GTTTTGGAGCAATGTGCATTTGCTTCAAAA TCCAGGTTTCTTAATATGTTCTGAAATCAC 2014-07-19 2014-07-19
snp_cf0004000000162 Basenji G GTTTTGGAGCAATGTGCATTTGCTTCAAAA TCCAGGTTTCTTAATATGTTCTGAAATCAC 2014-07-19 2014-07-19
snp_cf0008000000104 DQ10 G GTTTTGGAGCAATGTGCATTTGCTTCAAAA TCCAGGTTTCTTAATATGTTCTGAAATCAC 2014-07-19 2014-07-19
snp_cf0053000000213 LJ8 G GTTTTGGAGCAATGTGCATTTGCTTCAAAA TCCAGGTTTCTTAATATGTTCTGAAATCAC 2014-07-19 2014-07-19
snp_cf0027000000239 GS3 G GTTTTGGAGCAATGTGCATTTGCTTCAAAA TCCAGGTTTCTTAATATGTTCTGAAATCAC 2014-07-19 2014-07-19
snp_cf0049000000194 LJ4 G GTTTTGGAGCAATGTGCATTTGCTTCAAAA TCCAGGTTTCTTAATATGTTCTGAAATCAC 2014-07-19 2014-07-19
snp_cf0071000000174 YJ2 G GTTTTGGAGCAATGTGCATTTGCTTCAAAA TCCAGGTTTCTTAATATGTTCTGAAATCAC 2014-07-19 2014-07-19
snp_cf0065000000499 TM6 G GTTTTGGAGCAATGTGCATTTGCTTCAAAA TCCAGGTTTCTTAATATGTTCTGAAATCAC 2014-07-19 2014-07-19
snp_cf0012000000176 DQ4 G GTTTTGGAGCAATGTGCATTTGCTTCAAAA TCCAGGTTTCTTAATATGTTCTGAAATCAC 2014-07-19 2014-07-19
snp_cf0048000000180 LJ3 G GTTTTGGAGCAATGTGCATTTGCTTCAAAA TCCAGGTTTCTTAATATGTTCTGAAATCAC 2014-07-19 2014-07-19
snp_cf0030000000213 GS6 G GTTTTGGAGCAATGTGCATTTGCTTCAAAA TCCAGGTTTCTTAATATGTTCTGAAATCAC 2014-07-19 2014-07-19
snp_cf0040000000241 KM5 G GTTTTGGAGCAATGTGCATTTGCTTCAAAA TCCAGGTTTCTTAATATGTTCTGAAATCAC 2014-07-19 2014-07-19
snp_cf0051000000120 LJ6 G GTTTTGGAGCAATGTGCATTTGCTTCAAAA TCCAGGTTTCTTAATATGTTCTGAAATCAC 2014-07-19 2014-07-19
snp_cf0006000000177 CRW G GTTTTGGAGCAATGTGCATTTGCTTCAAAA TCCAGGTTTCTTAATATGTTCTGAAATCAC 2014-07-19 2014-07-19
snp_cf0032000000231 GS8 G GTTTTGGAGCAATGTGCATTTGCTTCAAAA TCCAGGTTTCTTAATATGTTCTGAAATCAC 2014-07-19 2014-07-19
snp_cf0016000000189 DQ8 G GTTTTGGAGCAATGTGCATTTGCTTCAAAA TCCAGGTTTCTTAATATGTTCTGAAATCAC 2014-07-19 2014-07-19
snp_cf0054000000164 LJ9 G GTTTTGGAGCAATGTGCATTTGCTTCAAAA TCCAGGTTTCTTAATATGTTCTGAAATCAC 2014-07-19 2014-07-19
snp_cf0045000000165 LJ10 G GTTTTGGAGCAATGTGCATTTGCTTCAAAA TCCAGGTTTCTTAATATGTTCTGAAATCAC 2014-07-19 2014-07-19
snp_cf0036000000205 KM1 G GTTTTGGAGCAATGTGCATTTGCTTCAAAA TCCAGGTTTCTTAATATGTTCTGAAATCAC 2014-07-19 2014-07-19
snp_cf0042000000281 KM7 G GTTTTGGAGCAATGTGCATTTGCTTCAAAA TCCAGGTTTCTTAATATGTTCTGAAATCAC 2014-07-19 2014-07-19
snp_cf0060000000169 TM1 G GTTTTGGAGCAATGTGCATTTGCTTCAAAA TCCAGGTTTCTTAATATGTTCTGAAATCAC 2014-07-19 2014-07-19
snp_cf0026000000162 GS2 G GTTTTGGAGCAATGTGCATTTGCTTCAAAA TCCAGGTTTCTTAATATGTTCTGAAATCAC 2014-07-19 2014-07-19
snp_cf0056000000463 LUPWRUS00001 G GTTTTGGAGCAATGTGCATTTGCTTCAAAA TCCAGGTTTCTTAATATGTTCTGAAATCAC 2014-07-19 2014-07-19
snp_cf0024000000167 GS10 G GTTTTGGAGCAATGTGCATTTGCTTCAAAA TCCAGGTTTCTTAATATGTTCTGAAATCAC 2014-07-19 2014-07-19
snp_cf0075000000193 YJ6 G GTTTTGGAGCAATGTGCATTTGCTTCAAAA TCCAGGTTTCTTAATATGTTCTGAAATCAC 2014-07-19 2014-07-19
snp_cf0077000000193 YJ8 G GTTTTGGAGCAATGTGCATTTGCTTCAAAA TCCAGGTTTCTTAATATGTTCTGAAATCAC 2014-07-19 2014-07-19
snp_cf0052000000179 LJ7 G GTTTTGGAGCAATGTGCATTTGCTTCAAAA TCCAGGTTTCTTAATATGTTCTGAAATCAC 2014-07-19 2014-07-19
snp_cf0067000000182 TM8 G GTTTTGGAGCAATGTGCATTTGCTTCAAAA TCCAGGTTTCTTAATATGTTCTGAAATCAC 2014-07-19 2014-07-19
snp_cf0063000000196 TM4 G GTTTTGGAGCAATGTGCATTTGCTTCAAAA TCCAGGTTTCTTAATATGTTCTGAAATCAC 2014-07-19 2014-07-19
snp_cf0044000000188 KM9 G GTTTTGGAGCAATGTGCATTTGCTTCAAAA TCCAGGTTTCTTAATATGTTCTGAAATCAC 2014-07-19 2014-07-19
snp_cf0050000000181 LJ5 G GTTTTGGAGCAATGTGCATTTGCTTCAAAA TCCAGGTTTCTTAATATGTTCTGAAATCAC 2014-07-19 2014-07-19
snp_cf0029000000164 GS5 G GTTTTGGAGCAATGTGCATTTGCTTCAAAA TCCAGGTTTCTTAATATGTTCTGAAATCAC 2014-07-19 2014-07-19
snp_cf0076000000182 YJ7 G GTTTTGGAGCAATGTGCATTTGCTTCAAAA TCCAGGTTTCTTAATATGTTCTGAAATCAC 2014-07-19 2014-07-19
snp_cf0057000000175 LUPWRUS00002 G GTTTTGGAGCAATGTGCATTTGCTTCAAAA TCCAGGTTTCTTAATATGTTCTGAAATCAC 2014-07-19 2014-07-19
snp_cf0070000000183 YJ1 G GTTTTGGAGCAATGTGCATTTGCTTCAAAA TCCAGGTTTCTTAATATGTTCTGAAATCAC 2014-07-19 2014-07-19
snp_cf0058000000307 LUPWRUS00003 G GTTTTGGAGCAATGTGCATTTGCTTCAAAA TCCAGGTTTCTTAATATGTTCTGAAATCAC 2014-07-19 2014-07-19
snp_cf0074000000212 YJ5 G GTTTTGGAGCAATGTGCATTTGCTTCAAAA TCCAGGTTTCTTAATATGTTCTGAAATCAC 2014-07-19 2014-07-19
snp_cf0038000000204 KM3 G GTTTTGGAGCAATGTGCATTTGCTTCAAAA TCCAGGTTTCTTAATATGTTCTGAAATCAC 2014-07-19 2014-07-19
snp_cf0021000000181 FAMICHN00001 G GTTTTGGAGCAATGTGCATTTGCTTCAAAA TCCAGGTTTCTTAATATGTTCTGAAATCAC 2014-07-19 2014-07-19
snp_cf0003000000407 dbSNP139 G GTTTTGGAGCAATGTGCATTTGCTTCAAAA TCCAGGTTTCTTAATATGTTCTGAAATCAC 2014-07-19 2014-07-19
snp_cf0039000000217 KM4 G GTTTTGGAGCAATGTGCATTTGCTTCAAAA TCCAGGTTTCTTAATATGTTCTGAAATCAC 2014-07-19 2014-07-19
snp_cf0073000000200 YJ4 G GTTTTGGAGCAATGTGCATTTGCTTCAAAA TCCAGGTTTCTTAATATGTTCTGAAATCAC 2014-07-19 2014-07-19
snp_cf0010000000177 DQ2 G GTTTTGGAGCAATGTGCATTTGCTTCAAAA TCCAGGTTTCTTAATATGTTCTGAAATCAC 2014-07-19 2014-07-19
snp_cf0009000000182 DQ1 G GTTTTGGAGCAATGTGCATTTGCTTCAAAA TCCAGGTTTCTTAATATGTTCTGAAATCAC 2014-07-19 2014-07-19
snp_cf0001000000274 solidGW1 G GTTTTGGAGCAATGTGCATTTGCTTCAAAA TCCAGGTTTCTTAATATGTTCTGAAATCAC 2014-08-01 2014-08-01
snp_cf0047000000118 LJ2 G GTTTTGGAGCAATGTGCATTTGCTTCAAAA TCCAGGTTTCTTAATATGTTCTGAAATCAC 2014-07-19 2014-07-19
snp_cf0033000000210 GS9 G GTTTTGGAGCAATGTGCATTTGCTTCAAAA TCCAGGTTTCTTAATATGTTCTGAAATCAC 2014-07-19 2014-07-19
snp_cf0007000000166 Dingo G GTTTTGGAGCAATGTGCATTTGCTTCAAAA TCCAGGTTTCTTAATATGTTCTGAAATCAC 2014-07-19 2014-07-19
snp_cf0020000000200 FAMBTIM00001 G GTTTTGGAGCAATGTGCATTTGCTTCAAAA TCCAGGTTTCTTAATATGTTCTGAAATCAC 2014-07-19 2014-07-19
snp_cf0031000000169 GS7 G GTTTTGGAGCAATGTGCATTTGCTTCAAAA TCCAGGTTTCTTAATATGTTCTGAAATCAC 2014-07-19 2014-07-19
snp_cf0062000000171 TM3 G GTTTTGGAGCAATGTGCATTTGCTTCAAAA TCCAGGTTTCTTAATATGTTCTGAAATCAC 2014-07-19 2014-07-19
snp_cf0002000000242 CID1 G GTTTTGGAGCAATGTGCATTTGCTTCAAAA TCCAGGTTTCTTAATATGTTCTGAAATCAC 2014-08-02 2014-08-02
snp_cf0015000000214 DQ7 G GTTTTGGAGCAATGTGCATTTGCTTCAAAA TCCAGGTTTCTTAATATGTTCTGAAATCAC 2014-07-19 2014-07-19
6.Fasta Information
TGCAGCCAAA GGCGCTGCTG GTTTTGGAGC AATGTGCATT TGCTTCAAAA
G
TCCAGGTTTC TTAATATGTT CTGAAATCAC GGACCTAAGT TTATTCTCCA