e.g. 1:1246..9423
SNP Detail For snp_cf0019000001208    [See in GBrowse]
1.General Information
SNP ID: snp_cf0019000001208
Organism: Canis familiaris
Individual: FAMBGSD00001
Create time: 2014-07-19
Last update: 2014-07-19
2.Allele Information
Platform: SOLEXA
Method: sequence
SNP Class: snp
Genotype: R
5'flank: CACAGCGGTGACAGACTCCAAGCGCACAGC
3'flank: GACCCAAAGAATGCCTGGCAGGACGCCAAC
3.Reference Map information
Chrom Position Reference FAMBGSD00001
Chr1 2919297 G R
4.Gene information
Gene model(s)
Gene ID Position in Gene Strands Gene Allele Location
ENSCAFG00000000016 59763 + G CDS
Transcript Protein
SNP to transcript Accession Position in Transcript Allele change Accession Position in Protein Residue change
+ ENSCAFT00000000025 210 GCG => GCA ENSCAFP00000000023 70 A => A
+ ENSCAFT00000000024 75 GCG => GCA ENSCAFP00000000022 25 A => A
5.SNPs of other individuals in this position
SNP_ID Individual Genotype 5' Near Seq 30 bp 3' Near Seq 30 bp Create time Last update time
snp_cf0040000001246 KM5 R CACAGCGGTGACAGACTCCAAGCGCACAGC GACCCAAAGAATGCCTGGCAGGACGCCAAC 2014-07-19 2014-07-19
snp_cf0036000001483 KM1 R CACAGCGGTGACAGACTCCAAGCGCACAGC GACCCAAAGAATGCCTGGCAGGACGCCAAC 2014-07-19 2014-07-19
snp_cf0025000001241 GS1 R CACAGCGGTGACAGACTCCAAGCGCACAGC GACCCAAAGAATGCCTGGCAGGACGCCAAC 2014-07-19 2014-07-19
snp_cf0045000000902 LJ10 R CACAGCGGTGACAGACTCCAAGCGCACAGC GACCCAAAGAATGCCTGGCAGGACGCCAAC 2014-07-19 2014-07-19
snp_cf0078000002101 YJ9 A CACAGCGGTGACAGACTCCAAGCGCACAGC GACCCAAAGAATGCCTGGCAGGACGCCAAC 2014-07-19 2014-07-19
snp_cf0035000001597 KM10 R CACAGCGGTGACAGACTCCAAGCGCACAGC GACCCAAAGAATGCCTGGCAGGACGCCAAC 2014-07-19 2014-07-19
snp_cf0032000001241 GS8 R CACAGCGGTGACAGACTCCAAGCGCACAGC GACCCAAAGAATGCCTGGCAGGACGCCAAC 2014-07-19 2014-07-19
snp_cf0043000002109 KM8 R CACAGCGGTGACAGACTCCAAGCGCACAGC GACCCAAAGAATGCCTGGCAGGACGCCAAC 2014-07-19 2014-07-19
snp_cf0027000001242 GS3 R CACAGCGGTGACAGACTCCAAGCGCACAGC GACCCAAAGAATGCCTGGCAGGACGCCAAC 2014-07-19 2014-07-19
6.Fasta Information
AATGGGACCC CCTCTCAGGA CACAGCGGTG ACAGACTCCA AGCGCACAGC
R
GACCCAAAGA ATGCCTGGCA GGACGCCAAC CCAGCTGACC CAGGGGGCCG