e.g. 1:1246..9423
SNP Detail For snp_cf0019000001394    [See in GBrowse]
1.General Information
SNP ID: snp_cf0019000001394
Organism: Canis familiaris
Individual: FAMBGSD00001
Create time: 2014-07-19
Last update: 2014-07-19
2.Allele Information
Platform: SOLEXA
Method: sequence
SNP Class: snp
Genotype: Y
5'flank: CGTAGGATGGCTGCATCTGCACGCTCTGCA
3'flank: GGCCGGCAGCGGCTTCACGGCACCGGGCAG
3.Reference Map information
Chrom Position Reference FAMBGSD00001
Chr1 4227658 T Y
4.Gene information
Gene model(s)
Gene ID Position in Gene Strands Gene Allele Location
ENSCAFG00000000020 3742 - T CDS
Transcript Protein
SNP to transcript Accession Position in Transcript Allele change Accession Position in Protein Residue change
- ENSCAFT00000036397 1777 ATG => GTG ENSCAFP00000031768 593 M => V
5.SNPs of other individuals in this position
SNP_ID Individual Genotype 5' Near Seq 30 bp 3' Near Seq 30 bp Create time Last update time
snp_cf0076000002298 YJ7 Y CGTAGGATGGCTGCATCTGCACGCTCTGCA GGCCGGCAGCGGCTTCACGGCACCGGGCAG 2014-07-19 2014-07-19
snp_cf0071000001736 YJ2 Y CGTAGGATGGCTGCATCTGCACGCTCTGCA GGCCGGCAGCGGCTTCACGGCACCGGGCAG 2014-07-19 2014-07-19
snp_cf0032000001427 GS8 Y CGTAGGATGGCTGCATCTGCACGCTCTGCA GGCCGGCAGCGGCTTCACGGCACCGGGCAG 2014-07-19 2014-07-19
snp_cf0044000002433 KM9 C CGTAGGATGGCTGCATCTGCACGCTCTGCA GGCCGGCAGCGGCTTCACGGCACCGGGCAG 2014-07-19 2014-07-19
snp_cf0022000002265 FAMICHN00002 C CGTAGGATGGCTGCATCTGCACGCTCTGCA GGCCGGCAGCGGCTTCACGGCACCGGGCAG 2014-07-19 2014-07-19
snp_cf0009000001441 DQ1 C CGTAGGATGGCTGCATCTGCACGCTCTGCA GGCCGGCAGCGGCTTCACGGCACCGGGCAG 2014-07-19 2014-07-19
snp_cf0016000001413 DQ8 Y CGTAGGATGGCTGCATCTGCACGCTCTGCA GGCCGGCAGCGGCTTCACGGCACCGGGCAG 2014-07-19 2014-07-19
snp_cf0011000003373 DQ3 C CGTAGGATGGCTGCATCTGCACGCTCTGCA GGCCGGCAGCGGCTTCACGGCACCGGGCAG 2014-07-19 2014-07-19
snp_cf0055000005488 LUPWCHN00001 C CGTAGGATGGCTGCATCTGCACGCTCTGCA GGCCGGCAGCGGCTTCACGGCACCGGGCAG 2014-07-19 2014-07-19
snp_cf0066000003409 TM7 C CGTAGGATGGCTGCATCTGCACGCTCTGCA GGCCGGCAGCGGCTTCACGGCACCGGGCAG 2014-07-19 2014-07-19
snp_cf0069000002639 YJ10 Y CGTAGGATGGCTGCATCTGCACGCTCTGCA GGCCGGCAGCGGCTTCACGGCACCGGGCAG 2014-07-19 2014-07-19
snp_cf0001000003910 solidGW1 C CGTAGGATGGCTGCATCTGCACGCTCTGCA GGCCGGCAGCGGCTTCACGGCACCGGGCAG 2014-08-01 2014-08-01
snp_cf0078000002311 YJ9 Y CGTAGGATGGCTGCATCTGCACGCTCTGCA GGCCGGCAGCGGCTTCACGGCACCGGGCAG 2014-07-19 2014-07-19
snp_cf0059000001935 TM10 Y CGTAGGATGGCTGCATCTGCACGCTCTGCA GGCCGGCAGCGGCTTCACGGCACCGGGCAG 2014-07-19 2014-07-19
snp_cf0015000002724 DQ7 C CGTAGGATGGCTGCATCTGCACGCTCTGCA GGCCGGCAGCGGCTTCACGGCACCGGGCAG 2014-07-19 2014-07-19
snp_cf0070000002543 YJ1 Y CGTAGGATGGCTGCATCTGCACGCTCTGCA GGCCGGCAGCGGCTTCACGGCACCGGGCAG 2014-07-19 2014-07-19
snp_cf0042000003602 KM7 Y CGTAGGATGGCTGCATCTGCACGCTCTGCA GGCCGGCAGCGGCTTCACGGCACCGGGCAG 2014-07-19 2014-07-19
snp_cf0074000002610 YJ5 Y CGTAGGATGGCTGCATCTGCACGCTCTGCA GGCCGGCAGCGGCTTCACGGCACCGGGCAG 2014-07-19 2014-07-19
snp_cf0017000002988 DQ9 C CGTAGGATGGCTGCATCTGCACGCTCTGCA GGCCGGCAGCGGCTTCACGGCACCGGGCAG 2014-07-19 2014-07-19
snp_cf0005000005183 CHW C CGTAGGATGGCTGCATCTGCACGCTCTGCA GGCCGGCAGCGGCTTCACGGCACCGGGCAG 2014-07-19 2014-07-19
snp_cf0012000001706 DQ4 C CGTAGGATGGCTGCATCTGCACGCTCTGCA GGCCGGCAGCGGCTTCACGGCACCGGGCAG 2014-07-19 2014-07-19
snp_cf0063000001971 TM4 C CGTAGGATGGCTGCATCTGCACGCTCTGCA GGCCGGCAGCGGCTTCACGGCACCGGGCAG 2014-07-19 2014-07-19
snp_cf0033000001605 GS9 C CGTAGGATGGCTGCATCTGCACGCTCTGCA GGCCGGCAGCGGCTTCACGGCACCGGGCAG 2014-07-19 2014-07-19
snp_cf0052000001854 LJ7 C CGTAGGATGGCTGCATCTGCACGCTCTGCA GGCCGGCAGCGGCTTCACGGCACCGGGCAG 2014-07-19 2014-07-19
snp_cf0013000001437 DQ5 C CGTAGGATGGCTGCATCTGCACGCTCTGCA GGCCGGCAGCGGCTTCACGGCACCGGGCAG 2014-07-19 2014-07-19
snp_cf0028000001198 GS4 C CGTAGGATGGCTGCATCTGCACGCTCTGCA GGCCGGCAGCGGCTTCACGGCACCGGGCAG 2014-07-19 2014-07-19
snp_cf0061000001984 TM2 C CGTAGGATGGCTGCATCTGCACGCTCTGCA GGCCGGCAGCGGCTTCACGGCACCGGGCAG 2014-07-19 2014-07-19
snp_cf0029000001207 GS5 C CGTAGGATGGCTGCATCTGCACGCTCTGCA GGCCGGCAGCGGCTTCACGGCACCGGGCAG 2014-07-19 2014-07-19
snp_cf0073000003761 YJ4 Y CGTAGGATGGCTGCATCTGCACGCTCTGCA GGCCGGCAGCGGCTTCACGGCACCGGGCAG 2014-07-19 2014-07-19
snp_cf0065000002927 TM6 Y CGTAGGATGGCTGCATCTGCACGCTCTGCA GGCCGGCAGCGGCTTCACGGCACCGGGCAG 2014-07-19 2014-07-19
snp_cf0057000005412 LUPWRUS00002 C CGTAGGATGGCTGCATCTGCACGCTCTGCA GGCCGGCAGCGGCTTCACGGCACCGGGCAG 2014-07-19 2014-07-19
snp_cf0035000002179 KM10 Y CGTAGGATGGCTGCATCTGCACGCTCTGCA GGCCGGCAGCGGCTTCACGGCACCGGGCAG 2014-07-19 2014-07-19
snp_cf0067000003046 TM8 C CGTAGGATGGCTGCATCTGCACGCTCTGCA GGCCGGCAGCGGCTTCACGGCACCGGGCAG 2014-07-19 2014-07-19
snp_cf0018000002632 FAMBBEM00001 Y CGTAGGATGGCTGCATCTGCACGCTCTGCA GGCCGGCAGCGGCTTCACGGCACCGGGCAG 2014-07-19 2014-07-19
snp_cf0060000001210 TM1 C CGTAGGATGGCTGCATCTGCACGCTCTGCA GGCCGGCAGCGGCTTCACGGCACCGGGCAG 2014-07-19 2014-07-19
snp_cf0026000001204 GS2 C CGTAGGATGGCTGCATCTGCACGCTCTGCA GGCCGGCAGCGGCTTCACGGCACCGGGCAG 2014-07-19 2014-07-19
snp_cf0038000002819 KM3 Y CGTAGGATGGCTGCATCTGCACGCTCTGCA GGCCGGCAGCGGCTTCACGGCACCGGGCAG 2014-07-19 2014-07-19
snp_cf0041000003503 KM6 Y CGTAGGATGGCTGCATCTGCACGCTCTGCA GGCCGGCAGCGGCTTCACGGCACCGGGCAG 2014-07-19 2014-07-19
snp_cf0021000001733 FAMICHN00001 C CGTAGGATGGCTGCATCTGCACGCTCTGCA GGCCGGCAGCGGCTTCACGGCACCGGGCAG 2014-07-19 2014-07-19
snp_cf0058000005871 LUPWRUS00003 Y CGTAGGATGGCTGCATCTGCACGCTCTGCA GGCCGGCAGCGGCTTCACGGCACCGGGCAG 2014-07-19 2014-07-19
snp_cf0039000002473 KM4 C CGTAGGATGGCTGCATCTGCACGCTCTGCA GGCCGGCAGCGGCTTCACGGCACCGGGCAG 2014-07-19 2014-07-19
snp_cf0024000001214 GS10 C CGTAGGATGGCTGCATCTGCACGCTCTGCA GGCCGGCAGCGGCTTCACGGCACCGGGCAG 2014-07-19 2014-07-19
snp_cf0025000001427 GS1 Y CGTAGGATGGCTGCATCTGCACGCTCTGCA GGCCGGCAGCGGCTTCACGGCACCGGGCAG 2014-07-19 2014-07-19
snp_cf0072000002250 YJ3 C CGTAGGATGGCTGCATCTGCACGCTCTGCA GGCCGGCAGCGGCTTCACGGCACCGGGCAG 2014-07-19 2014-07-19
snp_cf0006000005154 CRW Y CGTAGGATGGCTGCATCTGCACGCTCTGCA GGCCGGCAGCGGCTTCACGGCACCGGGCAG 2014-07-19 2014-07-19
snp_cf0056000005159 LUPWRUS00001 C CGTAGGATGGCTGCATCTGCACGCTCTGCA GGCCGGCAGCGGCTTCACGGCACCGGGCAG 2014-07-19 2014-07-19
snp_cf0010000001717 DQ2 C CGTAGGATGGCTGCATCTGCACGCTCTGCA GGCCGGCAGCGGCTTCACGGCACCGGGCAG 2014-07-19 2014-07-19
snp_cf0030000001608 GS6 C CGTAGGATGGCTGCATCTGCACGCTCTGCA GGCCGGCAGCGGCTTCACGGCACCGGGCAG 2014-07-19 2014-07-19
snp_cf0062000001747 TM3 C CGTAGGATGGCTGCATCTGCACGCTCTGCA GGCCGGCAGCGGCTTCACGGCACCGGGCAG 2014-07-19 2014-07-19
snp_cf0064000002763 TM5 Y CGTAGGATGGCTGCATCTGCACGCTCTGCA GGCCGGCAGCGGCTTCACGGCACCGGGCAG 2014-07-19 2014-07-19
snp_cf0077000002257 YJ8 Y CGTAGGATGGCTGCATCTGCACGCTCTGCA GGCCGGCAGCGGCTTCACGGCACCGGGCAG 2014-07-19 2014-07-19
snp_cf0049000002466 LJ4 Y CGTAGGATGGCTGCATCTGCACGCTCTGCA GGCCGGCAGCGGCTTCACGGCACCGGGCAG 2014-07-19 2014-07-19
snp_cf0068000001197 TM9 C CGTAGGATGGCTGCATCTGCACGCTCTGCA GGCCGGCAGCGGCTTCACGGCACCGGGCAG 2014-07-19 2014-07-19
snp_cf0008000002427 DQ10 C CGTAGGATGGCTGCATCTGCACGCTCTGCA GGCCGGCAGCGGCTTCACGGCACCGGGCAG 2014-07-19 2014-07-19
snp_cf0031000001215 GS7 C CGTAGGATGGCTGCATCTGCACGCTCTGCA GGCCGGCAGCGGCTTCACGGCACCGGGCAG 2014-07-19 2014-07-19
snp_cf0014000002745 DQ6 C CGTAGGATGGCTGCATCTGCACGCTCTGCA GGCCGGCAGCGGCTTCACGGCACCGGGCAG 2014-07-19 2014-07-19
snp_cf0027000001425 GS3 Y CGTAGGATGGCTGCATCTGCACGCTCTGCA GGCCGGCAGCGGCTTCACGGCACCGGGCAG 2014-07-19 2014-07-19
snp_cf0040000001430 KM5 Y CGTAGGATGGCTGCATCTGCACGCTCTGCA GGCCGGCAGCGGCTTCACGGCACCGGGCAG 2014-07-19 2014-07-19
snp_cf0034000005599 ISW C CGTAGGATGGCTGCATCTGCACGCTCTGCA GGCCGGCAGCGGCTTCACGGCACCGGGCAG 2014-07-19 2014-07-19
6.Fasta Information
CAGCGGCTTC ACGCCGCCCG CGTAGGATGG CTGCATCTGC ACGCTCTGCA
Y
GGCCGGCAGC GGCTTCACGG CACCGGGCAG CTGGTAGGCC GCGTGGATGC