e.g. 1:1246..9423
SNP Detail For snp_cf0019000001584    [See in GBrowse]
1.General Information
SNP ID: snp_cf0019000001584
Organism: Canis familiaris
Individual: FAMBGSD00001
Create time: 2014-07-19
Last update: 2014-07-19
2.Allele Information
Platform: SOLEXA
Method: sequence
SNP Class: snp
Genotype: R
5'flank: ATCTTCCCGTCTAGCAGGCTGCACATCCAA
3'flank: TGGCCATAGAAGCACACAGTGGGTTTCTTT
3.Reference Map information
Chrom Position Reference FAMBGSD00001
Chr1 4893368 G R
4.Gene information
Gene model(s)
Gene ID Position in Gene Strands Gene Allele Location
ENSCAFG00000000024 18609 - G CDS
Transcript Protein
SNP to transcript Accession Position in Transcript Allele change Accession Position in Protein Residue change
- ENSCAFT00000000039 393 CAC => CAT ENSCAFP00000000036 131 H => H
5.SNPs of other individuals in this position
SNP_ID Individual Genotype 5' Near Seq 30 bp 3' Near Seq 30 bp Create time Last update time
snp_cf0057000006247 LUPWRUS00002 A ATCTTCCCGTCTAGCAGGCTGCACATCCAA TGGCCATAGAAGCACACAGTGGGTTTCTTT 2014-07-19 2014-07-19
snp_cf0058000006604 LUPWRUS00003 R ATCTTCCCGTCTAGCAGGCTGCACATCCAA TGGCCATAGAAGCACACAGTGGGTTTCTTT 2014-07-19 2014-07-19
snp_cf0040000001626 KM5 R ATCTTCCCGTCTAGCAGGCTGCACATCCAA TGGCCATAGAAGCACACAGTGGGTTTCTTT 2014-07-19 2014-07-19
snp_cf0036000002222 KM1 R ATCTTCCCGTCTAGCAGGCTGCACATCCAA TGGCCATAGAAGCACACAGTGGGTTTCTTT 2014-07-19 2014-07-19
snp_cf0055000006332 LUPWCHN00001 R ATCTTCCCGTCTAGCAGGCTGCACATCCAA TGGCCATAGAAGCACACAGTGGGTTTCTTT 2014-07-19 2014-07-19
snp_cf0078000002499 YJ9 R ATCTTCCCGTCTAGCAGGCTGCACATCCAA TGGCCATAGAAGCACACAGTGGGTTTCTTT 2014-07-19 2014-07-19
snp_cf0043000003169 KM8 R ATCTTCCCGTCTAGCAGGCTGCACATCCAA TGGCCATAGAAGCACACAGTGGGTTTCTTT 2014-07-19 2014-07-19
snp_cf0001000004355 solidGW1 A ATCTTCCCGTCTAGCAGGCTGCACATCCAA TGGCCATAGAAGCACACAGTGGGTTTCTTT 2014-08-01 2014-08-01
snp_cf0025000001628 GS1 R ATCTTCCCGTCTAGCAGGCTGCACATCCAA TGGCCATAGAAGCACACAGTGGGTTTCTTT 2014-07-19 2014-07-19
snp_cf0006000005540 CRW A ATCTTCCCGTCTAGCAGGCTGCACATCCAA TGGCCATAGAAGCACACAGTGGGTTTCTTT 2014-07-19 2014-07-19
snp_cf0032000001619 GS8 R ATCTTCCCGTCTAGCAGGCTGCACATCCAA TGGCCATAGAAGCACACAGTGGGTTTCTTT 2014-07-19 2014-07-19
snp_cf0034000006327 ISW A ATCTTCCCGTCTAGCAGGCTGCACATCCAA TGGCCATAGAAGCACACAGTGGGTTTCTTT 2014-07-19 2014-07-19
snp_cf0027000001619 GS3 R ATCTTCCCGTCTAGCAGGCTGCACATCCAA TGGCCATAGAAGCACACAGTGGGTTTCTTT 2014-07-19 2014-07-19
snp_cf0056000005920 LUPWRUS00001 A ATCTTCCCGTCTAGCAGGCTGCACATCCAA TGGCCATAGAAGCACACAGTGGGTTTCTTT 2014-07-19 2014-07-19
6.Fasta Information
TAAGGGTCTG TGAGCCACCC ATCTTCCCGT CTAGCAGGCT GCACATCCAA
R
TGGCCATAGA AGCACACAGT GGGTTTCTTT GGATCGTTCC CCAGTTCAGC