e.g. 1:1246..9423
SNP Detail For snp_cf0002000000010    [See in GBrowse]
1.General Information
SNP ID: snp_cf0002000000010
Organism: Canis familiaris
Individual: CID1
Create time: 2014-08-02
Last update: 2014-08-02
2.Allele Information
Platform: SOLiD
Method: sequence
SNP Class: snp
Genotype: G
5'flank: CTGCCTGCAGCTACCTTTTGCTTCCAAAAG
3'flank: CCTAGGCTCGCTGCTTCACCAAAGTGTTGG
3.Reference Map information
Chrom Position Reference CID1
Chr1 2176 T G
4.Gene information
Gene model(s)
Gene ID Position in Gene Strands Gene Allele Location
NA NA NA NA NA
Transcript Protein
SNP to transcript Accession Position in Transcript Allele change Accession Position in Protein Residue change
NA NA NA NA NA NA NA
5.SNPs of other individuals in this position
SNP_ID Individual Genotype 5' Near Seq 30 bp 3' Near Seq 30 bp Create time Last update time
NA NA NA NA NA NA NA
6.Fasta Information
ATGGCCTGTA ACCCTACCTC CTGCCTGCAG CTACCTTTTG CTTCCAAAAG
G
CCTAGGCTCG CTGCTTCACC AAAGTGTTGG GAGAGGTAAC TGTTGTCTCC