e.g. 1:1246..9423
SNP Detail For snp_cf0002002454008    [See in GBrowse]
1.General Information
SNP ID: snp_cf0002002454008
Organism: Canis familiaris
Individual: CID1
Create time: 2014-08-02
Last update: 2014-08-02
2.Allele Information
Platform: SOLiD
Method: sequence
SNP Class: snp
Genotype: C
5'flank: CAAGCCAAATATATCCGAAAGAAGGTCACT
3'flank: TCCTCTGTCAGCTCCTTTAGGTCTGTCAGG
3.Reference Map information
Chrom Position Reference CID1
Chr4 2407309 T C
4.Gene information
Gene model(s)
Gene ID Position in Gene Strands Gene Allele Location
ENSCAFG00000010034 692389 - T CDS
Transcript Protein
SNP to transcript Accession Position in Transcript Allele change Accession Position in Protein Residue change
- ENSCAFT00000044598 13086 GAA => GAG ENSCAFP00000040266 4362 E => E
- ENSCAFT00000015962 13095 GAA => GAG ENSCAFP00000014764 4365 E => E
5.SNPs of other individuals in this position
SNP_ID Individual Genotype 5' Near Seq 30 bp 3' Near Seq 30 bp Create time Last update time
snp_cf0026002899589 GS2 Y CAAGCCAAATATATCCGAAAGAAGGTCACT TCCTCTGTCAGCTCCTTTAGGTCTGTCAGG 2014-07-19 2014-07-19
snp_cf0059003696346 TM10 C CAAGCCAAATATATCCGAAAGAAGGTCACT TCCTCTGTCAGCTCCTTTAGGTCTGTCAGG 2014-07-19 2014-07-19
snp_cf0007003135077 Dingo C CAAGCCAAATATATCCGAAAGAAGGTCACT TCCTCTGTCAGCTCCTTTAGGTCTGTCAGG 2014-07-19 2014-07-19
snp_cf0043003106225 KM8 C CAAGCCAAATATATCCGAAAGAAGGTCACT TCCTCTGTCAGCTCCTTTAGGTCTGTCAGG 2014-07-19 2014-07-19
snp_cf0022003293915 FAMICHN00002 C CAAGCCAAATATATCCGAAAGAAGGTCACT TCCTCTGTCAGCTCCTTTAGGTCTGTCAGG 2014-07-19 2014-07-19
snp_cf0057004367147 LUPWRUS00002 C CAAGCCAAATATATCCGAAAGAAGGTCACT TCCTCTGTCAGCTCCTTTAGGTCTGTCAGG 2014-07-19 2014-07-19
snp_cf0066003786274 TM7 Y CAAGCCAAATATATCCGAAAGAAGGTCACT TCCTCTGTCAGCTCCTTTAGGTCTGTCAGG 2014-07-19 2014-07-19
snp_cf0046003442333 LJ1 Y CAAGCCAAATATATCCGAAAGAAGGTCACT TCCTCTGTCAGCTCCTTTAGGTCTGTCAGG 2014-07-19 2014-07-19
snp_cf0013003622027 DQ5 Y CAAGCCAAATATATCCGAAAGAAGGTCACT TCCTCTGTCAGCTCCTTTAGGTCTGTCAGG 2014-07-19 2014-07-19
snp_cf0078003776104 YJ9 Y CAAGCCAAATATATCCGAAAGAAGGTCACT TCCTCTGTCAGCTCCTTTAGGTCTGTCAGG 2014-07-19 2014-07-19
snp_cf0033002911131 GS9 C CAAGCCAAATATATCCGAAAGAAGGTCACT TCCTCTGTCAGCTCCTTTAGGTCTGTCAGG 2014-07-19 2014-07-19
snp_cf0069003813399 YJ10 C CAAGCCAAATATATCCGAAAGAAGGTCACT TCCTCTGTCAGCTCCTTTAGGTCTGTCAGG 2014-07-19 2014-07-19
snp_cf0068003654932 TM9 C CAAGCCAAATATATCCGAAAGAAGGTCACT TCCTCTGTCAGCTCCTTTAGGTCTGTCAGG 2014-07-19 2014-07-19
snp_cf0061003747618 TM2 Y CAAGCCAAATATATCCGAAAGAAGGTCACT TCCTCTGTCAGCTCCTTTAGGTCTGTCAGG 2014-07-19 2014-07-19
snp_cf0023003525876 FAMICHN00003 C CAAGCCAAATATATCCGAAAGAAGGTCACT TCCTCTGTCAGCTCCTTTAGGTCTGTCAGG 2014-07-19 2014-07-19
snp_cf0049003715809 LJ4 C CAAGCCAAATATATCCGAAAGAAGGTCACT TCCTCTGTCAGCTCCTTTAGGTCTGTCAGG 2014-07-19 2014-07-19
snp_cf0077003765498 YJ8 Y CAAGCCAAATATATCCGAAAGAAGGTCACT TCCTCTGTCAGCTCCTTTAGGTCTGTCAGG 2014-07-19 2014-07-19
snp_cf0039003107694 KM4 Y CAAGCCAAATATATCCGAAAGAAGGTCACT TCCTCTGTCAGCTCCTTTAGGTCTGTCAGG 2014-07-19 2014-07-19
snp_cf0027002896618 GS3 C CAAGCCAAATATATCCGAAAGAAGGTCACT TCCTCTGTCAGCTCCTTTAGGTCTGTCAGG 2014-07-19 2014-07-19
snp_cf0004003088363 Basenji C CAAGCCAAATATATCCGAAAGAAGGTCACT TCCTCTGTCAGCTCCTTTAGGTCTGTCAGG 2014-07-19 2014-07-19
snp_cf0016003697114 DQ8 Y CAAGCCAAATATATCCGAAAGAAGGTCACT TCCTCTGTCAGCTCCTTTAGGTCTGTCAGG 2014-07-19 2014-07-19
snp_cf0036002932280 KM1 C CAAGCCAAATATATCCGAAAGAAGGTCACT TCCTCTGTCAGCTCCTTTAGGTCTGTCAGG 2014-07-19 2014-07-19
snp_cf0050003434275 LJ5 C CAAGCCAAATATATCCGAAAGAAGGTCACT TCCTCTGTCAGCTCCTTTAGGTCTGTCAGG 2014-07-19 2014-07-19
snp_cf0018003068270 FAMBBEM00001 C CAAGCCAAATATATCCGAAAGAAGGTCACT TCCTCTGTCAGCTCCTTTAGGTCTGTCAGG 2014-07-19 2014-07-19
snp_cf0015003682863 DQ7 Y CAAGCCAAATATATCCGAAAGAAGGTCACT TCCTCTGTCAGCTCCTTTAGGTCTGTCAGG 2014-07-19 2014-07-19
snp_cf0035003582427 KM10 C CAAGCCAAATATATCCGAAAGAAGGTCACT TCCTCTGTCAGCTCCTTTAGGTCTGTCAGG 2014-07-19 2014-07-19
snp_cf0076003805899 YJ7 C CAAGCCAAATATATCCGAAAGAAGGTCACT TCCTCTGTCAGCTCCTTTAGGTCTGTCAGG 2014-07-19 2014-07-19
snp_cf0041003697739 KM6 C CAAGCCAAATATATCCGAAAGAAGGTCACT TCCTCTGTCAGCTCCTTTAGGTCTGTCAGG 2014-07-19 2014-07-19
snp_cf0021003540053 FAMICHN00001 Y CAAGCCAAATATATCCGAAAGAAGGTCACT TCCTCTGTCAGCTCCTTTAGGTCTGTCAGG 2014-07-19 2014-07-19
snp_cf0011003751952 DQ3 C CAAGCCAAATATATCCGAAAGAAGGTCACT TCCTCTGTCAGCTCCTTTAGGTCTGTCAGG 2014-07-19 2014-07-19
snp_cf0056004584464 LUPWRUS00001 Y CAAGCCAAATATATCCGAAAGAAGGTCACT TCCTCTGTCAGCTCCTTTAGGTCTGTCAGG 2014-07-19 2014-07-19
snp_cf0053003608501 LJ8 C CAAGCCAAATATATCCGAAAGAAGGTCACT TCCTCTGTCAGCTCCTTTAGGTCTGTCAGG 2014-07-19 2014-07-19
snp_cf0029002729333 GS5 C CAAGCCAAATATATCCGAAAGAAGGTCACT TCCTCTGTCAGCTCCTTTAGGTCTGTCAGG 2014-07-19 2014-07-19
snp_cf0010003708229 DQ2 C CAAGCCAAATATATCCGAAAGAAGGTCACT TCCTCTGTCAGCTCCTTTAGGTCTGTCAGG 2014-07-19 2014-07-19
snp_cf0058004549094 LUPWRUS00003 C CAAGCCAAATATATCCGAAAGAAGGTCACT TCCTCTGTCAGCTCCTTTAGGTCTGTCAGG 2014-07-19 2014-07-19
snp_cf0028002800544 GS4 C CAAGCCAAATATATCCGAAAGAAGGTCACT TCCTCTGTCAGCTCCTTTAGGTCTGTCAGG 2014-07-19 2014-07-19
snp_cf0063003638527 TM4 C CAAGCCAAATATATCCGAAAGAAGGTCACT TCCTCTGTCAGCTCCTTTAGGTCTGTCAGG 2014-07-19 2014-07-19
snp_cf0024002913454 GS10 C CAAGCCAAATATATCCGAAAGAAGGTCACT TCCTCTGTCAGCTCCTTTAGGTCTGTCAGG 2014-07-19 2014-07-19
snp_cf0073003716237 YJ4 C CAAGCCAAATATATCCGAAAGAAGGTCACT TCCTCTGTCAGCTCCTTTAGGTCTGTCAGG 2014-07-19 2014-07-19
snp_cf0052003629486 LJ7 C CAAGCCAAATATATCCGAAAGAAGGTCACT TCCTCTGTCAGCTCCTTTAGGTCTGTCAGG 2014-07-19 2014-07-19
snp_cf0051003691637 LJ6 C CAAGCCAAATATATCCGAAAGAAGGTCACT TCCTCTGTCAGCTCCTTTAGGTCTGTCAGG 2014-07-19 2014-07-19
snp_cf0012003692458 DQ4 Y CAAGCCAAATATATCCGAAAGAAGGTCACT TCCTCTGTCAGCTCCTTTAGGTCTGTCAGG 2014-07-19 2014-07-19
snp_cf0003002123011 dbSNP139 C CAAGCCAAATATATCCGAAAGAAGGTCACT TCCTCTGTCAGCTCCTTTAGGTCTGTCAGG 2014-07-19 2014-07-19
snp_cf0025002881495 GS1 Y CAAGCCAAATATATCCGAAAGAAGGTCACT TCCTCTGTCAGCTCCTTTAGGTCTGTCAGG 2014-07-19 2014-07-19
snp_cf0065003677994 TM6 C CAAGCCAAATATATCCGAAAGAAGGTCACT TCCTCTGTCAGCTCCTTTAGGTCTGTCAGG 2014-07-19 2014-07-19
snp_cf0062003696393 TM3 C CAAGCCAAATATATCCGAAAGAAGGTCACT TCCTCTGTCAGCTCCTTTAGGTCTGTCAGG 2014-07-19 2014-07-19
snp_cf0019002874102 FAMBGSD00001 C CAAGCCAAATATATCCGAAAGAAGGTCACT TCCTCTGTCAGCTCCTTTAGGTCTGTCAGG 2014-07-19 2014-07-19
snp_cf0070003915079 YJ1 C CAAGCCAAATATATCCGAAAGAAGGTCACT TCCTCTGTCAGCTCCTTTAGGTCTGTCAGG 2014-07-19 2014-07-19
snp_cf0072003791915 YJ3 C CAAGCCAAATATATCCGAAAGAAGGTCACT TCCTCTGTCAGCTCCTTTAGGTCTGTCAGG 2014-07-19 2014-07-19
snp_cf0064003724796 TM5 Y CAAGCCAAATATATCCGAAAGAAGGTCACT TCCTCTGTCAGCTCCTTTAGGTCTGTCAGG 2014-07-19 2014-07-19
snp_cf0048003517100 LJ3 C CAAGCCAAATATATCCGAAAGAAGGTCACT TCCTCTGTCAGCTCCTTTAGGTCTGTCAGG 2014-07-19 2014-07-19
snp_cf0071003781187 YJ2 Y CAAGCCAAATATATCCGAAAGAAGGTCACT TCCTCTGTCAGCTCCTTTAGGTCTGTCAGG 2014-07-19 2014-07-19
snp_cf0074003721353 YJ5 Y CAAGCCAAATATATCCGAAAGAAGGTCACT TCCTCTGTCAGCTCCTTTAGGTCTGTCAGG 2014-07-19 2014-07-19
snp_cf0067003641962 TM8 Y CAAGCCAAATATATCCGAAAGAAGGTCACT TCCTCTGTCAGCTCCTTTAGGTCTGTCAGG 2014-07-19 2014-07-19
snp_cf0075003784000 YJ6 C CAAGCCAAATATATCCGAAAGAAGGTCACT TCCTCTGTCAGCTCCTTTAGGTCTGTCAGG 2014-07-19 2014-07-19
snp_cf0031002932195 GS7 C CAAGCCAAATATATCCGAAAGAAGGTCACT TCCTCTGTCAGCTCCTTTAGGTCTGTCAGG 2014-07-19 2014-07-19
snp_cf0017003744427 DQ9 Y CAAGCCAAATATATCCGAAAGAAGGTCACT TCCTCTGTCAGCTCCTTTAGGTCTGTCAGG 2014-07-19 2014-07-19
snp_cf0044003256953 KM9 Y CAAGCCAAATATATCCGAAAGAAGGTCACT TCCTCTGTCAGCTCCTTTAGGTCTGTCAGG 2014-07-19 2014-07-19
snp_cf0008003743756 DQ10 C CAAGCCAAATATATCCGAAAGAAGGTCACT TCCTCTGTCAGCTCCTTTAGGTCTGTCAGG 2014-07-19 2014-07-19
snp_cf0060003609414 TM1 C CAAGCCAAATATATCCGAAAGAAGGTCACT TCCTCTGTCAGCTCCTTTAGGTCTGTCAGG 2014-07-19 2014-07-19
snp_cf0047003592043 LJ2 Y CAAGCCAAATATATCCGAAAGAAGGTCACT TCCTCTGTCAGCTCCTTTAGGTCTGTCAGG 2014-07-19 2014-07-19
snp_cf0038002975099 KM3 C CAAGCCAAATATATCCGAAAGAAGGTCACT TCCTCTGTCAGCTCCTTTAGGTCTGTCAGG 2014-07-19 2014-07-19
snp_cf0034004268251 ISW C CAAGCCAAATATATCCGAAAGAAGGTCACT TCCTCTGTCAGCTCCTTTAGGTCTGTCAGG 2014-07-19 2014-07-19
snp_cf0037003083689 KM2 C CAAGCCAAATATATCCGAAAGAAGGTCACT TCCTCTGTCAGCTCCTTTAGGTCTGTCAGG 2014-07-19 2014-07-19
snp_cf0040003207805 KM5 Y CAAGCCAAATATATCCGAAAGAAGGTCACT TCCTCTGTCAGCTCCTTTAGGTCTGTCAGG 2014-07-19 2014-07-19
snp_cf0045003369527 LJ10 C CAAGCCAAATATATCCGAAAGAAGGTCACT TCCTCTGTCAGCTCCTTTAGGTCTGTCAGG 2014-07-19 2014-07-19
snp_cf0005004407222 CHW Y CAAGCCAAATATATCCGAAAGAAGGTCACT TCCTCTGTCAGCTCCTTTAGGTCTGTCAGG 2014-07-19 2014-07-19
snp_cf0030002881250 GS6 C CAAGCCAAATATATCCGAAAGAAGGTCACT TCCTCTGTCAGCTCCTTTAGGTCTGTCAGG 2014-07-19 2014-07-19
snp_cf0032002858151 GS8 C CAAGCCAAATATATCCGAAAGAAGGTCACT TCCTCTGTCAGCTCCTTTAGGTCTGTCAGG 2014-07-19 2014-07-19
snp_cf0042003853916 KM7 C CAAGCCAAATATATCCGAAAGAAGGTCACT TCCTCTGTCAGCTCCTTTAGGTCTGTCAGG 2014-07-19 2014-07-19
snp_cf0014003662723 DQ6 Y CAAGCCAAATATATCCGAAAGAAGGTCACT TCCTCTGTCAGCTCCTTTAGGTCTGTCAGG 2014-07-19 2014-07-19
snp_cf0009003682643 DQ1 C CAAGCCAAATATATCCGAAAGAAGGTCACT TCCTCTGTCAGCTCCTTTAGGTCTGTCAGG 2014-07-19 2014-07-19
6.Fasta Information
CCTCCTTCTC TCTTCAGGTC CAAGCCAAAT ATATCCGAAA GAAGGTCACT
C
TCCTCTGTCA GCTCCTTTAG GTCTGTCAGG TCTTCTGAGG GCAGGGCAGC