e.g. 1:1246..9423
SNP Detail For snp_cf0002002454137    [See in GBrowse]
1.General Information
SNP ID: snp_cf0002002454137
Organism: Canis familiaris
Individual: CID1
Create time: 2014-08-02
Last update: 2014-08-02
2.Allele Information
Platform: SOLiD
Method: sequence
SNP Class: snp
Genotype: C
5'flank: GTAAAGCCTGAGAGTGTGATAGTGGAACTT
3'flank: AGCAGCTCCTCCTGCTCCGTCAATTCCAGT
3.Reference Map information
Chrom Position Reference CID1
Chr4 2589729 T C
4.Gene information
Gene model(s)
Gene ID Position in Gene Strands Gene Allele Location
ENSCAFG00000010034 509969 - T CDS
Transcript Protein
SNP to transcript Accession Position in Transcript Allele change Accession Position in Protein Residue change
- ENSCAFT00000044598 4935 CTA => CTG ENSCAFP00000040266 1645 L => L
- ENSCAFT00000015962 4908 CTA => CTG ENSCAFP00000014764 1636 L => L
5.SNPs of other individuals in this position
SNP_ID Individual Genotype 5' Near Seq 30 bp 3' Near Seq 30 bp Create time Last update time
snp_cf0019002874234 FAMBGSD00001 C GTAAAGCCTGAGAGTGTGATAGTGGAACTT AGCAGCTCCTCCTGCTCCGTCAATTCCAGT 2014-07-19 2014-07-19
snp_cf0008003744041 DQ10 C GTAAAGCCTGAGAGTGTGATAGTGGAACTT AGCAGCTCCTCCTGCTCCGTCAATTCCAGT 2014-07-19 2014-07-19
snp_cf0016003697396 DQ8 Y GTAAAGCCTGAGAGTGTGATAGTGGAACTT AGCAGCTCCTCCTGCTCCGTCAATTCCAGT 2014-07-19 2014-07-19
snp_cf0053003608801 LJ8 C GTAAAGCCTGAGAGTGTGATAGTGGAACTT AGCAGCTCCTCCTGCTCCGTCAATTCCAGT 2014-07-19 2014-07-19
snp_cf0047003592331 LJ2 Y GTAAAGCCTGAGAGTGTGATAGTGGAACTT AGCAGCTCCTCCTGCTCCGTCAATTCCAGT 2014-07-19 2014-07-19
snp_cf0010003708404 DQ2 C GTAAAGCCTGAGAGTGTGATAGTGGAACTT AGCAGCTCCTCCTGCTCCGTCAATTCCAGT 2014-07-19 2014-07-19
snp_cf0049003715980 LJ4 C GTAAAGCCTGAGAGTGTGATAGTGGAACTT AGCAGCTCCTCCTGCTCCGTCAATTCCAGT 2014-07-19 2014-07-19
snp_cf0073003716411 YJ4 C GTAAAGCCTGAGAGTGTGATAGTGGAACTT AGCAGCTCCTCCTGCTCCGTCAATTCCAGT 2014-07-19 2014-07-19
snp_cf0046003442613 LJ1 Y GTAAAGCCTGAGAGTGTGATAGTGGAACTT AGCAGCTCCTCCTGCTCCGTCAATTCCAGT 2014-07-19 2014-07-19
snp_cf0032002858284 GS8 C GTAAAGCCTGAGAGTGTGATAGTGGAACTT AGCAGCTCCTCCTGCTCCGTCAATTCCAGT 2014-07-19 2014-07-19
snp_cf0015003683165 DQ7 C GTAAAGCCTGAGAGTGTGATAGTGGAACTT AGCAGCTCCTCCTGCTCCGTCAATTCCAGT 2014-07-19 2014-07-19
snp_cf0074003721629 YJ5 Y GTAAAGCCTGAGAGTGTGATAGTGGAACTT AGCAGCTCCTCCTGCTCCGTCAATTCCAGT 2014-07-19 2014-07-19
snp_cf0012003692726 DQ4 Y GTAAAGCCTGAGAGTGTGATAGTGGAACTT AGCAGCTCCTCCTGCTCCGTCAATTCCAGT 2014-07-19 2014-07-19
snp_cf0003002123234 dbSNP139 C GTAAAGCCTGAGAGTGTGATAGTGGAACTT AGCAGCTCCTCCTGCTCCGTCAATTCCAGT 2014-07-19 2014-07-19
snp_cf0026002899852 GS2 Y GTAAAGCCTGAGAGTGTGATAGTGGAACTT AGCAGCTCCTCCTGCTCCGTCAATTCCAGT 2014-07-19 2014-07-19
snp_cf0070003915376 YJ1 C GTAAAGCCTGAGAGTGTGATAGTGGAACTT AGCAGCTCCTCCTGCTCCGTCAATTCCAGT 2014-07-19 2014-07-19
snp_cf0076003806078 YJ7 C GTAAAGCCTGAGAGTGTGATAGTGGAACTT AGCAGCTCCTCCTGCTCCGTCAATTCCAGT 2014-07-19 2014-07-19
snp_cf0025002881756 GS1 Y GTAAAGCCTGAGAGTGTGATAGTGGAACTT AGCAGCTCCTCCTGCTCCGTCAATTCCAGT 2014-07-19 2014-07-19
snp_cf0071003781440 YJ2 C GTAAAGCCTGAGAGTGTGATAGTGGAACTT AGCAGCTCCTCCTGCTCCGTCAATTCCAGT 2014-07-19 2014-07-19
snp_cf0054003383014 LJ9 Y GTAAAGCCTGAGAGTGTGATAGTGGAACTT AGCAGCTCCTCCTGCTCCGTCAATTCCAGT 2014-07-19 2014-07-19
snp_cf0042003854067 KM7 C GTAAAGCCTGAGAGTGTGATAGTGGAACTT AGCAGCTCCTCCTGCTCCGTCAATTCCAGT 2014-07-19 2014-07-19
snp_cf0028002800727 GS4 C GTAAAGCCTGAGAGTGTGATAGTGGAACTT AGCAGCTCCTCCTGCTCCGTCAATTCCAGT 2014-07-19 2014-07-19
snp_cf0064003725107 TM5 Y GTAAAGCCTGAGAGTGTGATAGTGGAACTT AGCAGCTCCTCCTGCTCCGTCAATTCCAGT 2014-07-19 2014-07-19
snp_cf0075003784182 YJ6 C GTAAAGCCTGAGAGTGTGATAGTGGAACTT AGCAGCTCCTCCTGCTCCGTCAATTCCAGT 2014-07-19 2014-07-19
snp_cf0051003691816 LJ6 C GTAAAGCCTGAGAGTGTGATAGTGGAACTT AGCAGCTCCTCCTGCTCCGTCAATTCCAGT 2014-07-19 2014-07-19
snp_cf0030002881430 GS6 C GTAAAGCCTGAGAGTGTGATAGTGGAACTT AGCAGCTCCTCCTGCTCCGTCAATTCCAGT 2014-07-19 2014-07-19
snp_cf0024002913587 GS10 C GTAAAGCCTGAGAGTGTGATAGTGGAACTT AGCAGCTCCTCCTGCTCCGTCAATTCCAGT 2014-07-19 2014-07-19
snp_cf0017003744697 DQ9 C GTAAAGCCTGAGAGTGTGATAGTGGAACTT AGCAGCTCCTCCTGCTCCGTCAATTCCAGT 2014-07-19 2014-07-19
snp_cf0020003661572 FAMBTIM00001 C GTAAAGCCTGAGAGTGTGATAGTGGAACTT AGCAGCTCCTCCTGCTCCGTCAATTCCAGT 2014-07-19 2014-07-19
snp_cf0066003786582 TM7 Y GTAAAGCCTGAGAGTGTGATAGTGGAACTT AGCAGCTCCTCCTGCTCCGTCAATTCCAGT 2014-07-19 2014-07-19
snp_cf0013003622310 DQ5 Y GTAAAGCCTGAGAGTGTGATAGTGGAACTT AGCAGCTCCTCCTGCTCCGTCAATTCCAGT 2014-07-19 2014-07-19
snp_cf0037003083821 KM2 C GTAAAGCCTGAGAGTGTGATAGTGGAACTT AGCAGCTCCTCCTGCTCCGTCAATTCCAGT 2014-07-19 2014-07-19
snp_cf0031002932327 GS7 C GTAAAGCCTGAGAGTGTGATAGTGGAACTT AGCAGCTCCTCCTGCTCCGTCAATTCCAGT 2014-07-19 2014-07-19
snp_cf0038002975232 KM3 C GTAAAGCCTGAGAGTGTGATAGTGGAACTT AGCAGCTCCTCCTGCTCCGTCAATTCCAGT 2014-07-19 2014-07-19
snp_cf0005004407523 CHW C GTAAAGCCTGAGAGTGTGATAGTGGAACTT AGCAGCTCCTCCTGCTCCGTCAATTCCAGT 2014-07-19 2014-07-19
snp_cf0045003369823 LJ10 C GTAAAGCCTGAGAGTGTGATAGTGGAACTT AGCAGCTCCTCCTGCTCCGTCAATTCCAGT 2014-07-19 2014-07-19
snp_cf0068003655153 TM9 C GTAAAGCCTGAGAGTGTGATAGTGGAACTT AGCAGCTCCTCCTGCTCCGTCAATTCCAGT 2014-07-19 2014-07-19
snp_cf0041003697885 KM6 C GTAAAGCCTGAGAGTGTGATAGTGGAACTT AGCAGCTCCTCCTGCTCCGTCAATTCCAGT 2014-07-19 2014-07-19
snp_cf0023003526096 FAMICHN00003 C GTAAAGCCTGAGAGTGTGATAGTGGAACTT AGCAGCTCCTCCTGCTCCGTCAATTCCAGT 2014-07-19 2014-07-19
snp_cf0078003776371 YJ9 C GTAAAGCCTGAGAGTGTGATAGTGGAACTT AGCAGCTCCTCCTGCTCCGTCAATTCCAGT 2014-07-19 2014-07-19
snp_cf0001001610884 solidGW1 C GTAAAGCCTGAGAGTGTGATAGTGGAACTT AGCAGCTCCTCCTGCTCCGTCAATTCCAGT 2014-08-01 2014-08-01
snp_cf0055004562342 LUPWCHN00001 C GTAAAGCCTGAGAGTGTGATAGTGGAACTT AGCAGCTCCTCCTGCTCCGTCAATTCCAGT 2014-07-19 2014-07-19
snp_cf0021003540256 FAMICHN00001 C GTAAAGCCTGAGAGTGTGATAGTGGAACTT AGCAGCTCCTCCTGCTCCGTCAATTCCAGT 2014-07-19 2014-07-19
snp_cf0077003765783 YJ8 Y GTAAAGCCTGAGAGTGTGATAGTGGAACTT AGCAGCTCCTCCTGCTCCGTCAATTCCAGT 2014-07-19 2014-07-19
snp_cf0011003752248 DQ3 C GTAAAGCCTGAGAGTGTGATAGTGGAACTT AGCAGCTCCTCCTGCTCCGTCAATTCCAGT 2014-07-19 2014-07-19
snp_cf0022003294078 FAMICHN00002 C GTAAAGCCTGAGAGTGTGATAGTGGAACTT AGCAGCTCCTCCTGCTCCGTCAATTCCAGT 2014-07-19 2014-07-19
snp_cf0062003696567 TM3 C GTAAAGCCTGAGAGTGTGATAGTGGAACTT AGCAGCTCCTCCTGCTCCGTCAATTCCAGT 2014-07-19 2014-07-19
snp_cf0072003792218 YJ3 C GTAAAGCCTGAGAGTGTGATAGTGGAACTT AGCAGCTCCTCCTGCTCCGTCAATTCCAGT 2014-07-19 2014-07-19
snp_cf0065003678135 TM6 C GTAAAGCCTGAGAGTGTGATAGTGGAACTT AGCAGCTCCTCCTGCTCCGTCAATTCCAGT 2014-07-19 2014-07-19
snp_cf0029002729494 GS5 C GTAAAGCCTGAGAGTGTGATAGTGGAACTT AGCAGCTCCTCCTGCTCCGTCAATTCCAGT 2014-07-19 2014-07-19
snp_cf0044003257217 KM9 Y GTAAAGCCTGAGAGTGTGATAGTGGAACTT AGCAGCTCCTCCTGCTCCGTCAATTCCAGT 2014-07-19 2014-07-19
snp_cf0067003642251 TM8 C GTAAAGCCTGAGAGTGTGATAGTGGAACTT AGCAGCTCCTCCTGCTCCGTCAATTCCAGT 2014-07-19 2014-07-19
snp_cf0035003582595 KM10 Y GTAAAGCCTGAGAGTGTGATAGTGGAACTT AGCAGCTCCTCCTGCTCCGTCAATTCCAGT 2014-07-19 2014-07-19
snp_cf0039003107956 KM4 Y GTAAAGCCTGAGAGTGTGATAGTGGAACTT AGCAGCTCCTCCTGCTCCGTCAATTCCAGT 2014-07-19 2014-07-19
snp_cf0027002896750 GS3 C GTAAAGCCTGAGAGTGTGATAGTGGAACTT AGCAGCTCCTCCTGCTCCGTCAATTCCAGT 2014-07-19 2014-07-19
snp_cf0034004268469 ISW C GTAAAGCCTGAGAGTGTGATAGTGGAACTT AGCAGCTCCTCCTGCTCCGTCAATTCCAGT 2014-07-19 2014-07-19
snp_cf0069003813575 YJ10 C GTAAAGCCTGAGAGTGTGATAGTGGAACTT AGCAGCTCCTCCTGCTCCGTCAATTCCAGT 2014-07-19 2014-07-19
snp_cf0009003682930 DQ1 C GTAAAGCCTGAGAGTGTGATAGTGGAACTT AGCAGCTCCTCCTGCTCCGTCAATTCCAGT 2014-07-19 2014-07-19
snp_cf0036002932412 KM1 C GTAAAGCCTGAGAGTGTGATAGTGGAACTT AGCAGCTCCTCCTGCTCCGTCAATTCCAGT 2014-07-19 2014-07-19
snp_cf0050003434418 LJ5 C GTAAAGCCTGAGAGTGTGATAGTGGAACTT AGCAGCTCCTCCTGCTCCGTCAATTCCAGT 2014-07-19 2014-07-19
snp_cf0007003135341 Dingo C GTAAAGCCTGAGAGTGTGATAGTGGAACTT AGCAGCTCCTCCTGCTCCGTCAATTCCAGT 2014-07-19 2014-07-19
snp_cf0063003638660 TM4 C GTAAAGCCTGAGAGTGTGATAGTGGAACTT AGCAGCTCCTCCTGCTCCGTCAATTCCAGT 2014-07-19 2014-07-19
snp_cf0056004584757 LUPWRUS00001 Y GTAAAGCCTGAGAGTGTGATAGTGGAACTT AGCAGCTCCTCCTGCTCCGTCAATTCCAGT 2014-07-19 2014-07-19
snp_cf0059003696573 TM10 C GTAAAGCCTGAGAGTGTGATAGTGGAACTT AGCAGCTCCTCCTGCTCCGTCAATTCCAGT 2014-07-19 2014-07-19
snp_cf0048003517264 LJ3 C GTAAAGCCTGAGAGTGTGATAGTGGAACTT AGCAGCTCCTCCTGCTCCGTCAATTCCAGT 2014-07-19 2014-07-19
snp_cf0040003208064 KM5 Y GTAAAGCCTGAGAGTGTGATAGTGGAACTT AGCAGCTCCTCCTGCTCCGTCAATTCCAGT 2014-07-19 2014-07-19
snp_cf0033002911312 GS9 C GTAAAGCCTGAGAGTGTGATAGTGGAACTT AGCAGCTCCTCCTGCTCCGTCAATTCCAGT 2014-07-19 2014-07-19
snp_cf0043003106359 KM8 C GTAAAGCCTGAGAGTGTGATAGTGGAACTT AGCAGCTCCTCCTGCTCCGTCAATTCCAGT 2014-07-19 2014-07-19
snp_cf0018003068407 FAMBBEM00001 C GTAAAGCCTGAGAGTGTGATAGTGGAACTT AGCAGCTCCTCCTGCTCCGTCAATTCCAGT 2014-07-19 2014-07-19
snp_cf0014003663018 DQ6 Y GTAAAGCCTGAGAGTGTGATAGTGGAACTT AGCAGCTCCTCCTGCTCCGTCAATTCCAGT 2014-07-19 2014-07-19
snp_cf0060003609698 TM1 C GTAAAGCCTGAGAGTGTGATAGTGGAACTT AGCAGCTCCTCCTGCTCCGTCAATTCCAGT 2014-07-19 2014-07-19
snp_cf0061003747918 TM2 C GTAAAGCCTGAGAGTGTGATAGTGGAACTT AGCAGCTCCTCCTGCTCCGTCAATTCCAGT 2014-07-19 2014-07-19
snp_cf0004003088506 Basenji C GTAAAGCCTGAGAGTGTGATAGTGGAACTT AGCAGCTCCTCCTGCTCCGTCAATTCCAGT 2014-07-19 2014-07-19
snp_cf0052003629673 LJ7 C GTAAAGCCTGAGAGTGTGATAGTGGAACTT AGCAGCTCCTCCTGCTCCGTCAATTCCAGT 2014-07-19 2014-07-19
6.Fasta Information
CCAAGGGCAC ACACAGCAGA GTAAAGCCTG AGAGTGTGAT AGTGGAACTT
C
AGCAGCTCCT CCTGCTCCGT CAATTCCAGT ATGTCCACTG ACCTGTGGAA