e.g. 1:1246..9423
SNP Detail For snp_cf0020001694881    [See in GBrowse]
1.General Information
SNP ID: snp_cf0020001694881
Organism: Canis familiaris
Individual: FAMBTIM00001
Create time: 2014-07-19
Last update: 2014-07-19
2.Allele Information
Platform: SOLEXA
Method: sequence
SNP Class: snp
Genotype: A
5'flank: GAATCGAATTGAATTGTAAAGAATCAAATC
3'flank: GATTGAATCGAATCGGACAGAATTGAATCG
3.Reference Map information
Chrom Position Reference FAMBTIM00001
Chr20 355 G A
4.Gene information
Gene model(s)
Gene ID Position in Gene Strands Gene Allele Location
NA NA NA NA NA
Transcript Protein
SNP to transcript Accession Position in Transcript Allele change Accession Position in Protein Residue change
NA NA NA NA NA NA NA
5.SNPs of other individuals in this position
SNP_ID Individual Genotype 5' Near Seq 30 bp 3' Near Seq 30 bp Create time Last update time
snp_cf0051001698911 LJ6 A GAATCGAATTGAATTGTAAAGAATCAAATC GATTGAATCGAATCGGACAGAATTGAATCG 2014-07-19 2014-07-19
snp_cf0037001444939 KM2 A GAATCGAATTGAATTGTAAAGAATCAAATC GATTGAATCGAATCGGACAGAATTGAATCG 2014-07-19 2014-07-19
snp_cf0049001721911 LJ4 A GAATCGAATTGAATTGTAAAGAATCAAATC GATTGAATCGAATCGGACAGAATTGAATCG 2014-07-19 2014-07-19
snp_cf0052001666811 LJ7 A GAATCGAATTGAATTGTAAAGAATCAAATC GATTGAATCGAATCGGACAGAATTGAATCG 2014-07-19 2014-07-19
snp_cf0076001760836 YJ7 A GAATCGAATTGAATTGTAAAGAATCAAATC GATTGAATCGAATCGGACAGAATTGAATCG 2014-07-19 2014-07-19
snp_cf0044001508185 KM9 A GAATCGAATTGAATTGTAAAGAATCAAATC GATTGAATCGAATCGGACAGAATTGAATCG 2014-07-19 2014-07-19
snp_cf0074001724997 YJ5 A GAATCGAATTGAATTGTAAAGAATCAAATC GATTGAATCGAATCGGACAGAATTGAATCG 2014-07-19 2014-07-19
snp_cf0025001331536 GS1 A GAATCGAATTGAATTGTAAAGAATCAAATC GATTGAATCGAATCGGACAGAATTGAATCG 2014-07-19 2014-07-19
snp_cf0078001745820 YJ9 A GAATCGAATTGAATTGTAAAGAATCAAATC GATTGAATCGAATCGGACAGAATTGAATCG 2014-07-19 2014-07-19
snp_cf0075001747523 YJ6 A GAATCGAATTGAATTGTAAAGAATCAAATC GATTGAATCGAATCGGACAGAATTGAATCG 2014-07-19 2014-07-19
snp_cf0019001305490 FAMBGSD00001 A GAATCGAATTGAATTGTAAAGAATCAAATC GATTGAATCGAATCGGACAGAATTGAATCG 2014-07-19 2014-07-19
snp_cf0004001434465 Basenji A GAATCGAATTGAATTGTAAAGAATCAAATC GATTGAATCGAATCGGACAGAATTGAATCG 2014-07-19 2014-07-19
snp_cf0050001583555 LJ5 A GAATCGAATTGAATTGTAAAGAATCAAATC GATTGAATCGAATCGGACAGAATTGAATCG 2014-07-19 2014-07-19
snp_cf0027001339373 GS3 A GAATCGAATTGAATTGTAAAGAATCAAATC GATTGAATCGAATCGGACAGAATTGAATCG 2014-07-19 2014-07-19
snp_cf0009001709261 DQ1 A GAATCGAATTGAATTGTAAAGAATCAAATC GATTGAATCGAATCGGACAGAATTGAATCG 2014-07-19 2014-07-19
snp_cf0063001682286 TM4 A GAATCGAATTGAATTGTAAAGAATCAAATC GATTGAATCGAATCGGACAGAATTGAATCG 2014-07-19 2014-07-19
snp_cf0008001705851 DQ10 A GAATCGAATTGAATTGTAAAGAATCAAATC GATTGAATCGAATCGGACAGAATTGAATCG 2014-07-19 2014-07-19
snp_cf0045001537201 LJ10 A GAATCGAATTGAATTGTAAAGAATCAAATC GATTGAATCGAATCGGACAGAATTGAATCG 2014-07-19 2014-07-19
snp_cf0046001581129 LJ1 A GAATCGAATTGAATTGTAAAGAATCAAATC GATTGAATCGAATCGGACAGAATTGAATCG 2014-07-19 2014-07-19
snp_cf0058002139449 LUPWRUS00003 A GAATCGAATTGAATTGTAAAGAATCAAATC GATTGAATCGAATCGGACAGAATTGAATCG 2014-07-19 2014-07-19
snp_cf0021001625735 FAMICHN00001 A GAATCGAATTGAATTGTAAAGAATCAAATC GATTGAATCGAATCGGACAGAATTGAATCG 2014-07-19 2014-07-19
snp_cf0072001754057 YJ3 A GAATCGAATTGAATTGTAAAGAATCAAATC GATTGAATCGAATCGGACAGAATTGAATCG 2014-07-19 2014-07-19
snp_cf0047001654294 LJ2 A GAATCGAATTGAATTGTAAAGAATCAAATC GATTGAATCGAATCGGACAGAATTGAATCG 2014-07-19 2014-07-19
snp_cf0062001712582 TM3 A GAATCGAATTGAATTGTAAAGAATCAAATC GATTGAATCGAATCGGACAGAATTGAATCG 2014-07-19 2014-07-19
snp_cf0071001742494 YJ2 A GAATCGAATTGAATTGTAAAGAATCAAATC GATTGAATCGAATCGGACAGAATTGAATCG 2014-07-19 2014-07-19
snp_cf0048001618339 LJ3 A GAATCGAATTGAATTGTAAAGAATCAAATC GATTGAATCGAATCGGACAGAATTGAATCG 2014-07-19 2014-07-19
snp_cf0061001732995 TM2 A GAATCGAATTGAATTGTAAAGAATCAAATC GATTGAATCGAATCGGACAGAATTGAATCG 2014-07-19 2014-07-19
snp_cf0064001718179 TM5 A GAATCGAATTGAATTGTAAAGAATCAAATC GATTGAATCGAATCGGACAGAATTGAATCG 2014-07-19 2014-07-19
snp_cf0018001438696 FAMBBEM00001 A GAATCGAATTGAATTGTAAAGAATCAAATC GATTGAATCGAATCGGACAGAATTGAATCG 2014-07-19 2014-07-19
snp_cf0065001689453 TM6 A GAATCGAATTGAATTGTAAAGAATCAAATC GATTGAATCGAATCGGACAGAATTGAATCG 2014-07-19 2014-07-19
snp_cf0066001742942 TM7 A GAATCGAATTGAATTGTAAAGAATCAAATC GATTGAATCGAATCGGACAGAATTGAATCG 2014-07-19 2014-07-19
snp_cf0033001343397 GS9 A GAATCGAATTGAATTGTAAAGAATCAAATC GATTGAATCGAATCGGACAGAATTGAATCG 2014-07-19 2014-07-19
snp_cf0022001528652 FAMICHN00002 A GAATCGAATTGAATTGTAAAGAATCAAATC GATTGAATCGAATCGGACAGAATTGAATCG 2014-07-19 2014-07-19
snp_cf0068001665329 TM9 A GAATCGAATTGAATTGTAAAGAATCAAATC GATTGAATCGAATCGGACAGAATTGAATCG 2014-07-19 2014-07-19
snp_cf0017001726663 DQ9 A GAATCGAATTGAATTGTAAAGAATCAAATC GATTGAATCGAATCGGACAGAATTGAATCG 2014-07-19 2014-07-19
snp_cf0040001516398 KM5 A GAATCGAATTGAATTGTAAAGAATCAAATC GATTGAATCGAATCGGACAGAATTGAATCG 2014-07-19 2014-07-19
snp_cf0026001313203 GS2 A GAATCGAATTGAATTGTAAAGAATCAAATC GATTGAATCGAATCGGACAGAATTGAATCG 2014-07-19 2014-07-19
snp_cf0056002161327 LUPWRUS00001 A GAATCGAATTGAATTGTAAAGAATCAAATC GATTGAATCGAATCGGACAGAATTGAATCG 2014-07-19 2014-07-19
snp_cf0042001786566 KM7 A GAATCGAATTGAATTGTAAAGAATCAAATC GATTGAATCGAATCGGACAGAATTGAATCG 2014-07-19 2014-07-19
snp_cf0005002029586 CHW A GAATCGAATTGAATTGTAAAGAATCAAATC GATTGAATCGAATCGGACAGAATTGAATCG 2014-07-19 2014-07-19
snp_cf0006001975420 CRW A GAATCGAATTGAATTGTAAAGAATCAAATC GATTGAATCGAATCGGACAGAATTGAATCG 2014-07-19 2014-07-19
snp_cf0060001678407 TM1 A GAATCGAATTGAATTGTAAAGAATCAAATC GATTGAATCGAATCGGACAGAATTGAATCG 2014-07-19 2014-07-19
snp_cf0069001765734 YJ10 A GAATCGAATTGAATTGTAAAGAATCAAATC GATTGAATCGAATCGGACAGAATTGAATCG 2014-07-19 2014-07-19
snp_cf0067001677803 TM8 A GAATCGAATTGAATTGTAAAGAATCAAATC GATTGAATCGAATCGGACAGAATTGAATCG 2014-07-19 2014-07-19
snp_cf0023001602670 FAMICHN00003 A GAATCGAATTGAATTGTAAAGAATCAAATC GATTGAATCGAATCGGACAGAATTGAATCG 2014-07-19 2014-07-19
snp_cf0073001702090 YJ4 A GAATCGAATTGAATTGTAAAGAATCAAATC GATTGAATCGAATCGGACAGAATTGAATCG 2014-07-19 2014-07-19
snp_cf0055002134618 LUPWCHN00001 A GAATCGAATTGAATTGTAAAGAATCAAATC GATTGAATCGAATCGGACAGAATTGAATCG 2014-07-19 2014-07-19
snp_cf0035001656970 KM10 A GAATCGAATTGAATTGTAAAGAATCAAATC GATTGAATCGAATCGGACAGAATTGAATCG 2014-07-19 2014-07-19
snp_cf0077001733765 YJ8 A GAATCGAATTGAATTGTAAAGAATCAAATC GATTGAATCGAATCGGACAGAATTGAATCG 2014-07-19 2014-07-19
snp_cf0016001711023 DQ8 A GAATCGAATTGAATTGTAAAGAATCAAATC GATTGAATCGAATCGGACAGAATTGAATCG 2014-07-19 2014-07-19
snp_cf0070001805960 YJ1 A GAATCGAATTGAATTGTAAAGAATCAAATC GATTGAATCGAATCGGACAGAATTGAATCG 2014-07-19 2014-07-19
snp_cf0043001436327 KM8 A GAATCGAATTGAATTGTAAAGAATCAAATC GATTGAATCGAATCGGACAGAATTGAATCG 2014-07-19 2014-07-19
snp_cf0011001733259 DQ3 A GAATCGAATTGAATTGTAAAGAATCAAATC GATTGAATCGAATCGGACAGAATTGAATCG 2014-07-19 2014-07-19
snp_cf0012001693086 DQ4 A GAATCGAATTGAATTGTAAAGAATCAAATC GATTGAATCGAATCGGACAGAATTGAATCG 2014-07-19 2014-07-19
snp_cf0015001706200 DQ7 A GAATCGAATTGAATTGTAAAGAATCAAATC GATTGAATCGAATCGGACAGAATTGAATCG 2014-07-19 2014-07-19
snp_cf0029001230362 GS5 A GAATCGAATTGAATTGTAAAGAATCAAATC GATTGAATCGAATCGGACAGAATTGAATCG 2014-07-19 2014-07-19
snp_cf0041001725162 KM6 A GAATCGAATTGAATTGTAAAGAATCAAATC GATTGAATCGAATCGGACAGAATTGAATCG 2014-07-19 2014-07-19
snp_cf0024001360237 GS10 A GAATCGAATTGAATTGTAAAGAATCAAATC GATTGAATCGAATCGGACAGAATTGAATCG 2014-07-19 2014-07-19
snp_cf0030001325392 GS6 A GAATCGAATTGAATTGTAAAGAATCAAATC GATTGAATCGAATCGGACAGAATTGAATCG 2014-07-19 2014-07-19
snp_cf0038001351946 KM3 A GAATCGAATTGAATTGTAAAGAATCAAATC GATTGAATCGAATCGGACAGAATTGAATCG 2014-07-19 2014-07-19
snp_cf0028001275181 GS4 A GAATCGAATTGAATTGTAAAGAATCAAATC GATTGAATCGAATCGGACAGAATTGAATCG 2014-07-19 2014-07-19
snp_cf0014001678290 DQ6 A GAATCGAATTGAATTGTAAAGAATCAAATC GATTGAATCGAATCGGACAGAATTGAATCG 2014-07-19 2014-07-19
snp_cf0034002012381 ISW A GAATCGAATTGAATTGTAAAGAATCAAATC GATTGAATCGAATCGGACAGAATTGAATCG 2014-07-19 2014-07-19
snp_cf0010001684964 DQ2 A GAATCGAATTGAATTGTAAAGAATCAAATC GATTGAATCGAATCGGACAGAATTGAATCG 2014-07-19 2014-07-19
snp_cf0059001700557 TM10 A GAATCGAATTGAATTGTAAAGAATCAAATC GATTGAATCGAATCGGACAGAATTGAATCG 2014-07-19 2014-07-19
snp_cf0053001658315 LJ8 A GAATCGAATTGAATTGTAAAGAATCAAATC GATTGAATCGAATCGGACAGAATTGAATCG 2014-07-19 2014-07-19
snp_cf0007001469595 Dingo A GAATCGAATTGAATTGTAAAGAATCAAATC GATTGAATCGAATCGGACAGAATTGAATCG 2014-07-19 2014-07-19
snp_cf0036001341257 KM1 A GAATCGAATTGAATTGTAAAGAATCAAATC GATTGAATCGAATCGGACAGAATTGAATCG 2014-07-19 2014-07-19
snp_cf0031001336087 GS7 A GAATCGAATTGAATTGTAAAGAATCAAATC GATTGAATCGAATCGGACAGAATTGAATCG 2014-07-19 2014-07-19
snp_cf0054001525414 LJ9 A GAATCGAATTGAATTGTAAAGAATCAAATC GATTGAATCGAATCGGACAGAATTGAATCG 2014-07-19 2014-07-19
snp_cf0032001311241 GS8 A GAATCGAATTGAATTGTAAAGAATCAAATC GATTGAATCGAATCGGACAGAATTGAATCG 2014-07-19 2014-07-19
snp_cf0039001410939 KM4 A GAATCGAATTGAATTGTAAAGAATCAAATC GATTGAATCGAATCGGACAGAATTGAATCG 2014-07-19 2014-07-19
snp_cf0013001628661 DQ5 A GAATCGAATTGAATTGTAAAGAATCAAATC GATTGAATCGAATCGGACAGAATTGAATCG 2014-07-19 2014-07-19
snp_cf0057002052037 LUPWRUS00002 A GAATCGAATTGAATTGTAAAGAATCAAATC GATTGAATCGAATCGGACAGAATTGAATCG 2014-07-19 2014-07-19
6.Fasta Information
GAATTGAAAA GAAACGAAGC GAATCGAATT GAATTGTAAA GAATCAAATC
A
GATTGAATCG AATCGGACAG AATTGAATCG ATCGAAAAGA ATCGAATTCG